ENZYMATIC COMPOSITION, RECOMBINANT FILAMENT FUNGUS HOSTING CELL, METHOD TO PRODUCE AN ENZYMATIC COMP

专利摘要:
enzymatic composition, host cell of recombinant filamentous fungus, method to produce an enzymatic composition, processes to degrade a cellulosic material, to synthesize a fermentation product, and to ferment a cellulosic material. the present invention relates to host cells of recombinant filamentous fungi that produce cellulolytic enzyme compositions and methods of producing and using the compositions.
公开号:BR112014004186B1
申请号:R112014004186-5
申请日:2012-08-23
公开日:2020-12-15
发明作者:Jeffrey Shasky；Suchindra Maiyuran；Amanda Fischer
申请人:Novozymes, Inc.；
IPC主号:

专利说明:

DECLARATION OF RIGHTS FOR INVENTIONS CARRIED OUT IN RESEARCH AND DEVELOPMENT SPONSORED BY THE FEDERAL GOVERNMENT
[0001] This invention was made with the assistance of the Government in the cooperation agreement DE-FC36-08GO18080, granted by the Department of Energy. The Government has certain rights in this invention. REFERENCE TO A SEQUENCE LISTING
[0002] This application contains a sequence listing in computer readable form, which is incorporated by reference here. BACKGROUND OF THE INVENTION FIELD OF THE INVENTION
[0003] The present invention relates to cellulolytic enzyme compositions; host cells of recombinant filamentous fungi that produce cellulolytic enzyme compositions and methods of producing and using the compositions. DESCRIPTION OF RELATED TECHNIQUE
[0004] Cellulose is a glucose polymer linked by beta-1,4 bonds. Many microorganisms produce enzymes that hydrolyze beta-linked glycans. These enzymes include endoglucanases, cellobriohydrolases and beta-glycosidases. Endoglucanases digest the cellulose polymer at random locations, opening it up to attack by cellobriohydrolases. Cellobiohydrolases sequentially release cellobiose molecules from the ends of the cellulose polymer. Cellobiosis is a dimer bound to water-soluble 1,4-beta glucose. Beta-glycosidases hydrolyze cellobiose into glucose.
[0005] The conversion of lignocellulosic raw materials into ethanol has the advantages of the immediate availability of large quantities of raw material, the advantage of avoiding burning or grounding the materials, and the cleaning of fuel ethanol. Wood, agricultural residues, herbaceous crops and municipal solid residues are considered raw materials for the production of ethanol. These materials mainly consist of cellulose, hemicellulose, and lignin. Once cellulose is converted to glucose, glucose is easily fermented by yeast in ethanol.
[0006] WO 2011/057140 discloses a cellobiohydrolase I of Aspergillus fumigatus and its gene. WO 2011/057140 discloses a cellobiohydrolase II fr Aspergillus fumigatus and its gene. WO 2005/047499 discloses a betaglucosidase from Aspergillus fumigatus and its gene. WO 2006/078256 discloses GH10 xylanases from Aspergillus fumigatus. WO 2011/057140 discloses a beta-xylosidase from Aspergillus fumigatus and its gene. WO 2011/041397 discloses a GH61 polypeptide from Penicillium sp. having better cellulolytic activity and its gene.
[0007] There is a need in the art for new cellulolytic enzyme compositions that can efficiently break down cellulosic material.
[0008] The present invention provides cellulolytic enzyme compositions and methods of producing and using the compositions. SUMMARY OF THE INVENTION
[0009] The present invention relates to enzymatic compositions, comprising (i) a cellobiohydrolase I from Aspergillus fumigatus-, (ii) a cellobiohydrolase II from Aspergillus fumigatus-, (iii) a beta-glucosidase from Aspergillus fumigatus or a variant of themselves; and (iv) a GH61 polypeptide from Penicilllium sp. having better cellulolytic activity; or their counterparts.
[00010] The present invention also relates to host cells of recombinant filamentous fungi, comprising polynucleotides encoding (i) a cellobiohydrolase I of Aspergillus fumigatus ', (ii) a cellobiohydrolase II of Aspergillus fumigatus', (iii) a beta- glucosidase from Aspergillus fumigatus or a variant thereof; and (iv) a GH61 polypeptide from »Penicilllium sp. having better cellulolytic activity; or similar counterparts.
[00011] The present invention also relates to methods of producing an enzyme composition, comprising: (a) cultivating a filamentous fungus host cell of the present invention under conditions that lead to the production of the enzyme composition; and optionally (b) recovering the enzyme composition.
[00012] The present invention also relates to processes for degrading a cellulosic material, comprising: treating the cellulosic material with an enzymatic composition of the present invention.
[00013] The present invention also relates to processes for synthesizing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzymatic composition of the present invention; (b) fermenting the saccharified cellulosic material with one or more (for example, several) fermenting microorganisms to synthesize the fermentation product; and (c) recovering the fermentation product from the fermentation.
[00014] The present invention additionally relates to the processes of fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more (for example, several) fermenting microorganisms, wherein the cellulosic material is saccharified with an enzymatic composition of the present invention. BRIEF DESCRIPTION OF THE FIGURES
[00015] Figure 1 shows a restriction map of plasmid pJfyS139.
[00016] Figure 2 shows a restriction map of plasmid pJfyS142.
[00017] Figure 3 shows a restriction map of plasmid pJfyS144.
[00018] Figure 4 shows a restriction map of plasmid pDM286.
[00019] Figure 5 shows a restriction map of plasmid pDFng 113-3.
[00020] Figure 6 shows a restriction map of plasmid pSMail39.
[00021] Figure 7 shows a restriction map of plasmid pSMail43.
[00022] Figure 8 shows a restriction map of plasmid pSMai229.
[00023] Figure 9 shows a restriction map of plasmid pAG57.
[00024] Figure 10 shows a restriction map of plasmid pDFngl24-l.
[00025] Figure 11 shows a restriction map of the plasmid pSaMe-AFGHIO.
[00026] Figure 12 shows a comparison of the percentage conversion of pretreated corn residue (PCS) by an enzyme composition comprising a cellobiohydrolase I from Aspergillus fumigatus-, a cellobiohydrolase II from Aspergillus fumigatus', a variant of beta-glucosidase from Aspergillus fumigatus', a GH61 polypeptide from Penicillium sp. having better cellulolytic activity, an Aspergillus fumigatus xylanase, and an Aspergillus fumigatus beta-xylosidase (“enzyme composition # 1”) in an enzymatic composition comprising a mixture of a GH10 xylanase from Aspergillus aculeatus and a cellulase preparation containing Trichoderma reeseii beta-glucosidase from Aspergillus fumigatus and GH61A polypeptide from Thermoascus aurantiacus (“enzyme composition # 2”). Definitions
[00027] Acetylxylan esterase: The term "acetylxylan esterase" means a carboxylesterase (EC 3.1.1.72) that catalyzes the hydrolysis of acetyl groups from polymeric xylan, acetylated xylose, acetylated glucose, alpha-naphthyl acetate and / -nitrophenyl. For purposes of the present invention, acetylxylan esterase activity is determined using 0.5 mM p-nitrophenylacetate as a substrate in 50 mM sodium acetate, pH 5.0, containing 0.01% TWEEN ™ 20 (polyoxyethylene sorbitan monolaurate). One unit of acetylxylan esterase is defined as the amount of enzyme capable of releasing 1 μmol anion>> nitrophenolate per minute at pH 5, 25 ° C.
[00028] Allelic variant: The term "allelic variant" means any of two or more (for example, several) alternative forms of a gene that occupies the same chromosomal locus. Allelic variation naturally increases through mutation, and can result in polymorphism in populations. Gene mutations can be silent (no change in the encoded polypeptide) or they can encode polypeptides with altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
[00029] Alpha-L-arabinofuranosidase: The term “alpha-L-arabinofuranosidase” means an alpha-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1.55) that catalyzes the hydrolysis of non-reduced alpha-L-arabinofuranoside residues in alpha- L-arabinosides. The enzyme acts on alpha-L-arabinofuranosides, alpha-L-arabinans containing (1,3) and / or (1,5) bonds, arabinoxylans and arabinogalactans. Alpha-L-arabinofuranosidase is also known as arabinosidase, alpha-arabinosidase, alpha-L-arabinosidase, alpha-arabinofuranosidase, alpha-L-arabinofuranosidase polysaccharide, alpha-L-arabinofuranoside hydrolase, L-arabinosidase, or alpha-L- arabinanase. For purposes of the present invention, alpha-L-arabinofuranosidase activity is determined using 5 mg of medium viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co. Wicklow, Ireland) per ml of 100 mM sodium acetate , pH 5, in a total volume of 200 μL for 30 minutes at 40 ° C, followed by analysis of arabinose by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
[00030] Alpha-glucuronidase: The term "alpha-glucuronidase" means an alpha-D-glucosiduronate glucuronohydrolase (EC 3.2.1.139) that catalyzes the hydrolysis of an alpha-D-glucuronoside to D-glucuronate and an alcohol. For the purposes of the present invention, alpha-glucuronidase activity is determined according to de Vries, 1998, J. Bacteriol. 180: 243-249. One unit of alpha-glucuronidase is equal to the amount of enzyme capable of releasing 1 μmol of glucuronic acid or 4-O-methylglucuronic per minute at pH 5, 40 ° C.
[00031] Aspartic protease: The term "aspartic protease" means a protease that uses an aspartate residue (s) to catalyze the hydrolysis of peptide bonds in peptides and proteins. Aspartic proteases are a family of protease enzymes that use an aspartate residue for the catalytic hydrolysis of their peptide substrates. In general, they present two very conserved aspartates in the active site, and are ideally active in acidic pH (Szecsi, 1992, Scand. J. Clin. Lab. In vest. Suppl. 210: 5-22). For purposes of the present invention, aspartic protease activity is determined according to the procedure described by Aikawa et al., 2001, J. Biochem. 129: 791-794.
[00032] Beta-glucosidase: The term "beta-glucosidase" means a beta-D-glucoside glucohydrolase (EC 3.2.1,21) that catalyzes the hydrolysis of terminal non-reducing beta-D-glucose residues with the release of beta -D- glucose. For purposes of the present invention, beta-glucosidase activity is determined using / - nitrophenyl-beta-D-glucopyranoside as a substrate according to the procedure of Venturi et al., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var . coprophilum '. production, purification and some biochemical properties, J. Basic Microbiol. 42: 55-66. One unit of beta-glycosidase is defined as 1.0 μmol of p-nitrophenolate anion produced per minute at 25 ° C, pH 4.8, from 1 mM / - nitrophenyl-beta-D-glucopyranoid as a citrate substrate 50 mM sodium containing 0.01% TWEEN® 20 (polyoxyethylene sorbitan monolaurate).
[00033] Beta-xylosidase: The term "beta-xylosidase" means a beta-D-xyloside xylohydrolase (EC 3.2.1.37) that catalyzes the exohydrolysis of beta - * (4) -xyl-oligosaccharides to remove successive residues of D-xylose from unreduced terminations. For the purposes of the present invention, a beta-xylosidase unit is defined as 1.0 μmol anion / 7-nitrophenolate produced per minute at 40 ° C, pH 5, from / - nitrophenyl-beta-D-xyloside 1 mM as a substrate in 100 mM sodium citrate containing 0.01% TWEEN® 20.
[00034] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription of a mature, joined mRNA molecule obtained from a eukaryotic cell. CDNA needs intron sequences that can be present in the corresponding genomic DNA. The initial and primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
[00035] Cellobiohydrolase: The term "cellobiohydrolase" means a 1,4-beta-D-glycan cellobiohydrolase (EC 3.2.1.91 and EC 3.2.1.176) that catalyzes the hydrolysis of 1,4-beta-D-glycosidic bonds in cellulose , cell-oligosaccharides, or any polymer containing glucose linked to beta-1,4, which releases cellobiose from the reduced or unreduced ends of the chain (Teeri, 1997, Crystalline cellulose degradation: New insight into the function of cellobiohydrolases, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Trichoderma reesei cellobiohydrolases: why so efficient on crystalline cellulose , Biochem. Soc. Trans. 26: 173-178). Cellobiohydrolase activity is determined according to the procedures described Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEBS Letters, 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters, 187: 283-288; and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581. In the present invention, the method by Tomme et al. can be used to determine cellobiohydrolase activity.
[00036] Cellulolytic enzyme or cellulase: The term "cellulolytic enzyme" or "cellulase" means one or more (for example, several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglucanase (s), cellobiohydrolase (s), beta-glycosidase (s) or combinations thereof. The two basic approaches to measuring cellulolytic activity include: (1) measuring total cellulolytic activity, and (2) measuring individual cellulolytic activities (endoglucanases, cellobiohydrolases, and beta-glycosidases) in the manner reviewed in Zhang et al., Outlook for cellulase improvement: Screening and selection strategies, 2006, Biotechnology Advances 24: 452-481. Total cellulolytic activity is generally measured using insoluble substrates, including Whatman N2I filter paper, microcrystalline cellulose, bacterial cellulose, algae cellulose, cotton, pretreated lignocellulose, etc. The most common total cellulolytic activity test is the paper filter test using Whatman N2I paper filter as the substrate. The assay was established by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, Pure Appl. Chem. 59: 257-68).
[00037] For purposes of the present invention, cellulolytic enzyme activity is determined by measuring the increase in hydrolysis of a cellulolytic material by the cellulolytic enzyme (s) under the following conditions: 1-50 mg of enzyme protein cellulolytic / g cellulose in PCS (or other pretreated cellulosic material) for 3-7 days at an appropriate temperature, for example, 50 ° C, 55 ° C, or 60 ° C, compared to a control hydrolysis without the addition of cellulolytic enzyme protein. Typical conditions are reactions of 1 mL, washed and unwashed PCS, 5% insoluble solids, 50 mM sodium acetate pH 5, 1 mM MnSCL, 50 ° C, 55 ° C, or 60 ° C, 72 hours, analysis of sugar per AMINEX® HPX-87H column (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
[00038] Cellulosic material: The term "cellulosic material" means any material containing cellulose. The predominant polysaccharide in the primary cell wall of the biomass is cellulose, the second most abundant is hemicellulose and the third is pectin. The secondary cell wall, produced after the cell stops growing, also contains polysaccharides and is reinforced by polymeric lignin covalently cross-linked to hemicellulose. Cellulose is a homopolymer of anhydrocelobiosis and thus a linear beta- (1-4) -D-glycan, while hemicelluloses include a variety of compounds, such as xylans, xyloglycans, arabinoxylans and mannans in complex branched structures with a spectrum substituents. Although generally polymorphic, cellulose is found in plant tissue primarily as an insoluble crystalline matrix of parallel glycan chains. Hemicelluloses in general bind hydrogen to cellulose, as well as other hemicelluloses, which helps to stabilize the cell wall matrix.
[00039] Cellulose is found in general, for example, in the stems, leaves, sepals, barks and cobs of plants or leaves, branches and wood of trees. Cellulolytic material can be, but is not limited to, agricultural waste, herbaceous material (including energy-providing crops), municipal solid waste, pulp and ground paper waste, waste paper and wood (including forest waste) (see, for example, Wiselogel et al., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Taylor & Francis, Washington DC; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24/25: 695-719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering / Biotechnology, T. Scheper, managing editor, Volume 65, pp.23-40, Springer- Verlag, New York). It is understood here that cellulose may be in the form of lignocellulose, a plant cell wall material containing lignin, cellulose and hemicellulose in a mixed matrix. In a preferred aspect, the cellulolytic material is any biomass material. In another preferred aspect, the cellulosic material is lignocellulose, which comprises cellulose, hemicelluloses and lignin.
[00040] In one aspect, cellulosic material is agricultural waste. In another aspect, the cellulosic material is herbaceous waste (including crops for energy production). In another aspect, cellulosic material is municipal solid waste. In another aspect, the cellulosic material is pulp and ground paper residue. In another aspect, the cellulosic material is waste paper. In another aspect, the cellulosic material is wood (including forest waste).
[00041] In another aspect, the cellulosic material is arundo. In another aspect, the cellulosic material is bagasse. In another aspect, the cellulosic material is bamboo. In another aspect, the cellulosic material is ear of corn. In another aspect, the cellulosic material is corn fiber. In another aspect, the cellulosic material is corn residue. In another aspect, the cellulosic material is Miscanthus. In another aspect, the cellulosic material is orange house. In another aspect, the cellulosic material is rice straw. In another aspect, the cellulosic material is yellow millet. In another aspect, the cellulosic material is wheat straw.
[00042] In another aspect, the cellulosic material is aspen. In another aspect, the cellulosic material is eucalyptus. In another aspect, the cellulosic material is pine. In another aspect, the cellulosic material is pine. In another aspect, the cellulosic material is poplar. In another aspect, the cellulosic material is spruce. In another aspect, the cellulosic material is willow.
[00043] In another aspect, the cellulosic material is algae cellulose. In another aspect, the cellulosic material is bacterial cellulose. In another aspect, the cellulosic material is cotton lint. In another aspect, the cellulosic material is filter paper. In another aspect, the cellulosic material is microcrystalline cellulose. In another aspect, the cellulosic material is cellulose treated with phosphoric acid.
[00044] In another aspect, the cellulosic material is an aquatic biomass. As used herein, the term "aquatic biomass" means biomass produced in an aquatic environment by a process of photosynthesis. The aquatic biomass can be seaweed, emerging plants, plants with floating leaves or submerged plants.
[00045] The cellulolytic material can be used as is, or can be subjected to pretreatment, using conventional methods known in the art, in the manner described here. In a preferred aspect, the cellulolytic material is pre-treated.
[00046] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The limits of the coding sequence are generally determined by an open reading frame, which begins with an initial codon such as ATG, GTG, or TTG, and ends with a stop codon such as TAA, TAG or TGA. The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.
[00047] Control sequences: The term "control sequences" means nucleic acid sequences necessary for the expression of a polynucleotide that encodes a polypeptide. Each control sequence can be natural (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or natural or foreign to each other. Such control sequences include, but are not limited to,> a major sequence, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence and transcription terminator. At a minimum, control sequences include a promoter and transcriptional and translational stop signals. Control sequences can be provided with linkers for the purpose of introducing specific restriction sites that facilitate the binding of control sequences with the coding region of the polynucleotide that encodes a polypeptide.
[00048] Endoglucanase: The term "endoglucanase" means an endo-1,3,4 (1,3,3,4) -beta-D-glycan 4-glycanhydrolase (EC 3.2.1.4), which catalyzes the endohydrolysis of 1,4-beta-D-glycosidic bonds in cellulose, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenine, beta-1,4 bonds in mixed beta-1,3 glycans, such as beta-D-glycans or cereal xyloglycans and other plant material containing cellulolytic components. Endoglucanase activity can be determined by measuring the reduction in substrate viscosity or the increase in edge reduction determined by a sugar reduction assay (Zhang et al., 2006, Biotechnology Advances 24: 452-481). For purposes of the present invention, endoglucanase activity is determined using carboxymethyl cellulose (CMC) as a substrate according to the procedure of Ghose, 1987, Pure and Appl. Chem. 59: 257-268, at pH 5, 40 ° C.
[00049] Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.
[00050] Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide that encodes a polypeptide, and is operably linked to control sequences that provide its expression.
[00051] Glycoside hydrolase family 61: The term "Glycoside hydrolase family 61" or "GH61 family" or "GH61" means a polypeptide that belongs to the glycoside hydrolase family 61 according to Henrissat, 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem. J. 280: 309-316, and Henrissat, and Bairoch. 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem. J. 316: 695-696. The enzymes in this family were originally classified as a family of glycoside hydrolase based on the measurement of the very weak activity of endo-1,4-beta-D-glucanase in a family member. The structure and mode of action of these enzymes are non-canonical and cannot be considered as authentic glycosidases. However, they are maintained in the CAZy classification based on their ability to improve the breakdown of lignocellulose when used in conjunction with a cellulase or a mixture of cellulases.
[00052] Feruloyl esterase: The term "feruloyl esterase" means a hydrolysis of the 4-hydroxy-3-methoxycinnamyl sugar (EC 3.1.1.73) which catalyzes the hydrolysis of the 4-hydroxy-3-methoxycinnamyl (feruloyl) groups from the sugar esterified, which is generally arabinose on natural biomass substrates, to produce ferulate (4-hydroxy-3-methoxycinnamate). Feruloyl esterase is also known as ferulic acid esterase, hydroxycinnamyl esterase, FAE-III, cinnamoyl ester hydrolase, FAEA, cinnAE, FAE-I, or FAE-II. For purposes of the present invention, feruloyl esterase activity is determined using 0.5 mM p-nitrophenylferulate as a substrate in 50 mM sodium acetate, pH 5.0. One unit of feruloyl esterase is equivalent to the amount of enzyme capable of releasing 1 μmol anion / - nitrophenolate per minute at pH 5, 25 ° C.
[00053] Flanking: The term "flanking" means sequences of DNA that extend either next to a specific sequence of DNA, locus, or gene. The flanking DNA is immediately adjacent to another DNA sequence, locus, or gene that is integrated into the genome of a filamentous fungal cell.
[00054] Fragment: The term "fragment" means a polypeptide with one or more (for example, several) amino acids missing from the amino and / or carboxyl terminus of a main mature polypeptide; where the fragment shows enzyme activity. In one aspect, a fragment contains at least 85%, for example, at least 90% or at least 95% of the amino acid residues of an enzyme's mature polypeptide.
[00055] Hemicellulolytic enzyme or hemicellulase: The term "hemicellulolytic enzyme" or "hemicellulase" means one or more (for example, several) enzymes that hydrolyze a hemicellulosic material. See, for example, Shallom, D. and Shoham, Y. Microbial hemicelullases. Current Opinion in Microbiology, 2003, 6 (3): 219-228). Hemicellulases are key components in the degradation of plant biomass. Examples of hemicellulases include, but are not limited to, an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a mannosidase, a mannosidase, an and a xylosidase. The substrates of these enzymes, hemicelluloses, are a heterogeneous group of branched and linear polysaccharides that are linked by means of hydrogen bonds to the cellulose microfibrils on the plant cell wall, cross-linking them in a strong network. Hemicelluloses are also covalently attached to lignin, forming together with cellulose a very complex structure. The variable structure and organization of hemicelluloses requires the combined action of many enzymes for their complete degradation. The catalytic modules of hemicellulases are both glycoside hydrolases (GHs), which hydrolyze glycosidic bonds, and carbohydrate esterases (CEs), which hydrolyze acetate ester bonds or lateral groups of ferulic acid. These catalytic modes, based on the homology of their primary sequence, can be determined in the GH and CE families. Some families, with a similar full fold, can be further grouped into clans, marked alphabetically (for example, GH-A). A more informative classification and an updated classification of these and other enzymes active in carbohydrates are available in the Carbohydrate-Active Enzymes (CAZy) database. The activities of the hemicellulolytic enzyme can be evaluated according to Ghose and Bisaria, 1987, Pure & AppI. Chem. 59: 1739-1752, at a suitable temperature, for example, 50 ° C, 55 ° C, or 60 ° C, and at pH, for example, 5.0 or 5.5.
[00056] High severity conditions: The term "high severity conditions" means probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 micrograms / mL of denatured and sheared DNA from salmon sperm, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 65 ° C.
[00057] Homologous region 3 'or 5': The term "homologous region 3" 'means a DNA fragment that is identical in sequence or has a sequence identity of at least 70%, for example, at least 75%, at least at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with a region in the genome, and when combined with a 5 'homologous region can target the integration of a DNA fragment at a specific site in the genome by homologous recombination. The term "homologous region 5" 'means a DNA fragment that is identical in sequence to a region in the genome, and when combined with a 3' homologous region it can target the integration of a DNA fragment with a specific site in the genome by recombination homologous. The 5 'and 3' homologous regions have to be linked in the genome, which means that they are on the same chromosome and at least 200 kb from one another.
[00058] Flanking homologous region: The term "flanking homologous region" means a DNA fragment that is identical or has a sequence identity of at least 70%, for example, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with a region in the genome and is located immediately upstream or downstream of a specific site in the genome where extracellular DNA is targeted for integration.
[00059] Homologous repetition: The term "homologous repetition" means a fragment of DNA that is repeated at least twice in the recombinant DNA introduced into a host cell, and that can facilitate the loss of DNA, that is, selectable marker that is inserted between two homologous repetitions, by homologous recombination. A homologous repetition is also known as a direct repetition.
[00060] Host cell: The term "host cell" means any type of cell that is susceptible to transformation, transfection, transduction, or similar to a nucleic acid construct or expression vector that comprises a polynucleotide that encodes a polypeptide. The term "host cell" includes any progeny of a mother cell that is not identical to the mother cell because of the mutations that occur during replication.
[00061] Isolated: The term "isolated" means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor that is at least partially removed from one or more, or all, the naturally occurring constituents with which it is associated in nature; (3) any substance modified by human manipulation related to that substance found in nature; or (4) any substance modified by increasing the amount of the substance related to other components with which it is naturally associated (for example, recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a more promoter stronger than the promoter naturally associated with the gene encoding the substance).
[00062] Low severity conditions: The term "low severity conditions" means probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 micrograms / mL of denatured and sheared DNA from salmon sperm, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each, for 15 minutes, using 2X SSC, 0.2% SDS at 50 ° C.
[00063] Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form after translation and any of the post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide of an A. fumigatus cellobiohydrolase I has amino acids 27 to 532 of SEQ ID NO: 2 based on the SignalP program (Nielsen et al., 1997, Protein Engineering 10: 1-6) which provides that amino acids 1 to 26 of SEQ ID NO: 2 are a signal peptide. In another aspect, the mature polypeptide of an A. fumigatus cellobiohydrolase II has amino acids 20 to 454 of SEQ ID NO: 4 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 4 are a peptide signal. In another aspect, the mature A. fumigatus beta-glucosidase polypeptide has amino acids 20 to 863 of SEQ ID NO: 6 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 6 are a signal peptide. In another aspect, the mature polypeptide of a GH61 polypeptide from Penicillium sp. shows amino acids 26 to 253 of SEQ ID NO: 8 based on the SignalP program which predicts that amino acids 1 to 25 of SEQ ID NO: 8 are a signal peptide. In another aspect, the mature polypeptide from an A. fumigatus xylanase I has amino acids 18 to 364 of SEQ ID NO: 10 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 10 are a peptide signal. In another aspect, the mature polypeptide from an A. fumigatus xylanase II has amino acids 20 to 323 of SEQ ID NO: 12 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 12 are a peptide signal. In another aspect, the mature polypeptide from an A. fumigatus xylanase III has amino acids 20 to 397 of SEQ ID NO: 14 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 14 are a peptide signal. In another aspect, the mature polypeptide of an A. fumigatus beta-xylosidase has amino acids 21 to 792 of SEQ ID NO: 16 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 16 are a signal peptide.
[00064] In another aspect, the mature polypeptide of a T. reesei cellobiohydrolase I has amino acids 18 to 514 of SEQ ID NO: 18 based on the SignalP program which predicts that amino acids 1 to 17 of SEQ ID NO: 18 are a signal peptide. In another aspect, the mature polypeptide of a T. reesei cellobiohydrolase II has amino acids 19 to 471 of SEQ ID NO: 20 based on the SignalP program which predicts that amino acids 1 to 18 of SEQ ID NO: 20 are a peptide signal. In another aspect, the mature polypeptide of a T. reesei beta-glucosidase has amino acids 20 to 744 of SEQ ID NO: 22 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 22 are a signal peptide. In another aspect, the mature polypeptide from a T. reesei xylanase I has amino acids 20 to 229 of SEQ ID NO: 24 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 24 are a peptide signal. In another aspect, the mature polypeptide from a T. reesei xylanase II has amino acids 20 to 223 of SEQ ID NO: 26 based on the SignalP program which predicts that amino acids 1 to 19 of SEQ ID NO: 26 are a peptide signal. In another aspect, the mature T. reesei xylanase III polypeptide has amino acids 17 to 347 of SEQ ID NO: 28 based on the SignalP program which predicts that amino acids 1 to 16 of SEQ ID NO: 28 are a peptide signal. In another aspect, the mature polypeptide from a T. reesei beta-xylosidase has amino acids 21 to 797 of SEQ ID NO: 30 based on the SignalP program which predicts that amino acids 1 to 20 of SEQ ID NO: 30 are a signal peptide. It is known in the art that a host cell can produce a mixture of two or more different mature polypeptides (i.e., with a different C-terminal and / or N-terminal amino acid) expressed by the same polynucleotide.
[00065] Sequence encoding the mature polypeptide: The term "sequence encoding the mature polypeptide" means a polynucleotide that encodes a mature polypeptide with enzyme activity. In one aspect, the sequence encoding the mature polypeptide of an A. fumigatus cellobiohydrolase I has nucleotides 79 to 1596 of SEQ ID NO: 1 or their DNAc sequence based on the SignalP program (Nielsen et al., 1997 , supra) which predicts that nucleotides 1 to 78 of SEQ ID NO: 1 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of an A. fumigatus cellobiohydrolase II has nucleotides 58 to 1700 of SEQ ID NO: 3 or their DNAc sequence based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 3 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of an A. fumigatus beta-glucosidase has nucleotides 58 to 2580 of SEQ ID NO: 5 or the DNAc sequence thereof based on the SignalP program which predicts that the nucleotides 1 to 57 of SEQ ID NO: 5 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a GH61 polypeptide from Penicillium sp. shows nucleotides 76 to 832 of SEQ ID NO: 7 or the cDNA sequence thereof based on the SignalP program which predicts that nucleotides 1 to 75 of SEQ ID NO: 7 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of an A. fumigatus xylanase I has nucleotides 52 to 1145 of SEQ ID NO: 9 or their cDNA sequence based on the SignalP program which predicts that nucleotides 1 to 51 of SEQ ID NO: 9 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of an A. fumigatus xylanase II has nucleotides 58 to 1400 of SEQ ID NO: 11 or their DNAc sequence based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 11 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of an A. fumigatus xylanase III has nucleotides 107 to 1415 of SEQ ID NO: 13 or their cDNA sequence based on the SignalP program which predicts that nucleotides 1 to 106 of SEQ ID NO: 13 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of an A. fumigatus beta-xylosidase has nucleotides 61 to 2373 of SEQ ID NO: 15 or their DNAc sequence based on the SignalP program which predicts that the nucleotides 1 to 60 of SEQ ID NO: 15 encode a signal peptide.
[00066] In another aspect, the sequence encoding the mature polypeptide of a T. reesei cellobiohydrolase I presents nucleotides 52 to 1545 of SEQ ID NO: 17 or their DNAc sequence based on the SignalP program which provides that nucleotides 1 to 51 of SEQ ID NO: 17 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a T. reesei cellobiohydrolase II presents nucleotides 55 to 1608 of SEQ ID NO: 19 or their cDNA sequence based on the SignalP program which predicts that nucleotides 1 to 54 of SEQ ID NO: 19 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a beta-glucosidase from T. reesei presents nucleotides 58 to 2612 of SEQ ID NO: 21 or their cDNA sequence based on the SignalP program which predicts that the nucleotides 1 to 57 of SEQ ID NO: 21 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a T. reesei xylanase I has nucleotides 58 to 749 of SEQ ID NO: 23 or the cDNA sequence thereof based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 23 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a T reesei xylanase II has nucleotides 58 to 778 of SEQ ID NO: 25 or their cDNA sequence based on the SignalP program which predicts that nucleotides 1 to 57 of SEQ ID NO: 25 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a T. reesei xylanase III has nucleotides 49 through 1349 of SEQ ID NO: 27 or their cDNA sequence based on the SignalP program which predicts that nucleotides 1 to 48 of SEQ ID NO: 27 encode a signal peptide. In another aspect, the sequence encoding the mature polypeptide of a T reesei beta-xylosidase presents nucleotides 61 to 2391 of SEQ ID NO: 29 or their cDNA sequence based on the SignalP program which predicts that nucleotides 1 to 60 of SEQ ID NO: 29 encode a signal peptide.
[00067] Medium severity conditions: The term "medium severity conditions" means probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 micrograms / mL of denatured and sheared salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 55 ° C.
[00068] Medium-high severity conditions: The term "medium-high severity conditions" means probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ° C in SSPE 5X, 0.3% SDS, 200 micrograms / mL of denatured and sheared salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 60 ° C.
[00069] Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, both single-stranded and double-stranded, that is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a way that may not exist otherwise in nature, or that is synthetic, comprising one or more (for example, several) control sequences.
[00070] Operably linked: The term "operably linked" means a configuration in which a control sequence is placed in an appropriate position, with respect to the coding sequence of a polynucleotide, in such a way that the control sequence directs the expression of the coding sequence.
[00071] Polypeptide having better cellulolytic activity: The term "polypeptide having better cellulolytic activity" means a GH61 polypeptide that catalyzes the improvement of the hydrolysis of a cellulosic material by an enzyme that has cellulolytic activity. For the purposes of the present invention, the best cellulolytic activity is determined by assessing the increase in reducing sugars, or the increase in the total cellobiose and glucose from the hydrolysis of a cellulosic material by cellulolytic enzyme under the following conditions: 1-50 mg of protein total / g cellulose in PCS, where the total protein is comprised of 50-99.5% w / w of enzymatic cellulolytic protein and 0.5-50% w / w of protein of a GH61 polypeptide having better cellulolytic activity by 1-7 days at a suitable temperature, for example, 50 ° C, 55 ° C, or 60 ° C, and adequate pH, for example, 5.0 or 5.5, compared to a control hydrolysis with full protein loading equal, without better cellulolytic activity (1-50 mg cellulolytic protein / g cellulose in PCS). In a preferred aspect, a mixture of CELLUCLAST® 1.5 L (Novozymes A / S, Bagsvaerd, Denmark) in the presence of 2-3% by weight of total beta-glucosidase protein from Aspergillus oryzae (produced recombinantly in Aspergillus oryzae according to WO 02/095014), or 2-3% by weight of total beta-glucosidase protein from Aspergillus fumigatus (produced recombinantly in Aspergillus oryzae as described in WO 2002/095014) of the cellulase protein load is used as the source of cellulolytic activity.
[00072] GH61 polypeptides having better cellulolytic activity improve the hydrolysis of a cellulosic material, catalyzed by an enzyme that has cellulolytic activity, reducing the amount of cellulolytic enzyme required to achieve the same degree of hydrolysis, preferably at least 1.01 times, per example, at least 1.05 times, at least 1.10 times, at least 1.25 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, or at least 20 times.
[00073] Pre-treated corn residue: The term “PCS” or “pre-treated corn residue” means cellulolytic material derived from corn residue by heat treatment and diluted sulfuric acid, alkaline pretreatment or pretreatment neutral.
[00074] Sequence identity: The relationship between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
[00075] For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or higher. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the replacement matrix EBLOSUM62 (EMBOSS version of BLOSUM62). Needle yield marked as “best identity” (obtained using the non-summarized option) is used as the percentage identity and is calculated as follows: (Identical residuals x 100) / (Size of the alignment - Total number of intervals in the alignment )
[00076] For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra), as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or higher. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the replacement matrix EDNAFULL (EMBOSS version of NCBI NUC4.4). Needle yield marked as “best identity” (obtained using the non-summarized option) is used as the percentage identity and is calculated as follows: (Identical deoxyribonucleotides x 100) / (Alignment size - Total number of alignment intervals )
[00077] Substring: The term "subsequence" means a polynucleotide with one or more (for example, several) nucleotides missing from the 5 'and / or 3' ends of a sequence encoding the mature polypeptide; where the subsequence encodes a fragment with enzyme activity. In one aspect, a subsequence contains at least 85%, for example, at least 90% or at least 95% of the nucleotides in the sequence encoding the mature polypeptide of an enzyme.
[00078] Serine protease of the subtiiisine type: The term "serine protease of the subtiiisine type" means a protease with a substrate specificity similar to subtiiisin that uses a serine residue to catalyze the hydrolysis of peptide bonds in peptides and proteins. Subthiiisin-type proteases (subtilases) are serine proteases characterized by a catalytic triad of the three amino acids aspartate, histidine and serine. The arrangement of these catalytic residues is shared with the prototypical Bacillus licheniformis subtiiisin (Siezen and Leunissen, 1997, Protein Science 6: 501-523). The subtiiisin-like serine protease activity can be determined using a synthetic substrate, N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (AAPF) (Bachem AG, Bubendorf, Switzerland) in 100 mM NaCl - 100 mM MOPS pH 7.0 at 50 ° C for 3 hours, and then the absorbance at 405 nm was measured.
[00079] Targeted integration: The term "targeted integration" means the stable integration of extracellular DNA into a defined genomic locus.
[00080] Transformant: The term "Transformant" means a cell that absorbs extracellular DNA (foreign, artificial or modified) and expresses the gene (s) contained in it (s).
[00081] Transformation: The term "transformation" means the introduction of extracellular DNA into a cell, that is, the genetic alteration of a cell that results from the direct absorption, incorporation and expression of exogenous genetic material (exogenous DNA) from the region around, and absorbed through the cell membrane (s).
[00082] Trypsin-like serine protease: The term "trypsin-like serine protease" means a protease with a substrate specificity similar to trypsin that uses a serine residue to catalyze the hydrolysis of peptide bonds in peptides and proteins. For purposes of the present invention, trypsin-like serine protease activity is determined according to the procedure described by Dienes et al., 2007, Enzyme and Microbial Technology 40: 1087-1094.
[00083] Variant: The term "variant" means a polypeptide with enzyme activity comprising a change, that is, a substitution, insertion, and / or elimination, in one or more (for example, several) positions. A substitution means changing the amino acid that occupies a position with a different amino acid; an elimination means the removal of the amino acid that occupies a position; and an insertion means adding an amino acid adjacent and immediately after the amino acid that occupies a position.
[00084] Very high severity conditions: The term "very high severity conditions" means probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ° C in SSPE 5X, 0.3% SDS, 200 micrograms / mL of denatured and sheared DNA from salmon sperm and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 70 ° C.
[00085] Very low severity conditions: The term "very low severity conditions" means probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ° C in SSPE 5X, 0.3% SDS, 200 micrograms / mL of denatured and sheared salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45 ° C.
[00086] Xylan-containing material: The term "xylan-containing material" means any material that comprises a plant cell wall polysaccharide, containing a major portion of beta- (1-4) residues - bound to xylose. Terrestrial plant xylans are heteropolymers that have a major part of beta- (1-4) -D-xylopyranose, which is branched short chain carbohydrates. They comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose and / or various oligosaccharides composed of D-xylose, L-arabinose, D- or L-galactose and D-glucose. Xylan-type polysaccharides can be divided into homoxylans and heteroxylans, which include glucuronoxylans, (arabino) glucuronoxylans, (glucuron) arabinoxylans, arabinoxylans and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Know. 186: 1-67.
[00087] In the processes of the present invention, any material containing xylan can be used. In a preferred aspect, the material containing xylan is lignocellulose.
[00088] Activity that degrades xylan or xylanolitic activity: The term "activity that degrades xylan" or "xylanolitic activity" means a biological activity that hydrolyzes material containing xylan. The two basic approaches to measuring xylanolitic activity include: (1) measuring total xylanolitic activity, and (2) measuring individual xylanolitic activities (endoxylanases, beta-xylosidases, arabinofuranosidases, alpha-glucuronidases, acetylxylan esterases, feruloyl esterases, and alpha- glucuronyl esterases). Recent progress in the testing of xylanolitic enzymes has been summarized in, for example, several publications, including Biely and Puchard, Recent progress in the assays of xylanolytic enzymes, 2006, Journal of the Science of Food and Agriculture 86 (11): 1636-1647; Spanikova and Biely, 2006, Glicuronoyl esterase - Novel carbohydrate esterase produced by Schizophyllum commune, FEBS Letters 580 (19): 4597-4601; Herrmann, Vrsanska, Jurickova, Hirsch, Biely and Kubicek, 1997, The beta-D-xylosidase of Trichoderma reesei is a multifunctional beta-D-xylan xylohydrolase, Biochemical Journal 321: 375-381.
[00089] The total activity that degrades xylan can be measured by determining the reduction of sugars formed from various types of xylan including, for example, oat spelled xylans, beech wood and larch wood, or by photometric determination of fragments of colored xylan released from several covalently colored xylans. The most common total xylanolitic assay is based on the production of reduced sugars of polymeric 4-O-methyl glucuronoxylane, as described in Bailey, Biely, Poutanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23 (3): 257-270. Xylanase activity can also be determined with 0.2% AZCL-arabinoxylan as a substrate in TRITON® X-100 0.01% (4- (1,1,3,3-tetramethylbutyl) phenyl-polyethylene glycol) and buffer 200 mM sodium sulfate pH 6 at 37 ° C. One unit of xylanase activity is defined as 1.0 μmol of azurine produced per minute at 37 ° C, pH 6, from AZCL-arabinoxylan 0.2% as a substrate in 200 mM sodium phosphate buffer, pH 6.
[00090] For purposes of the present invention, the activity that degrades xylan is determined by measuring the increase in birch xylan hydrolysis (Sigma Chemical Co., Inc., St. Louis, MO, USA) by enzyme (s) that degrades ( m) xylan in the following typical conditions: reactions of 1 ml, 5 mg / ml of substrate (total solids), 5 mg of xylanolitic protein / g of substrate, 50 mM sodium acetate at pH 5, 50 ° C, 24 hours , sugar analysis using the / - hydroxybenzoic acid hydrazide assay (PHBAH) as described by Lever, 1972, A new reaction for colorimetric determination of carbohydrates, Anal. Biochem 47: 273-279.
[00091] Xylanase: The term "xylanase" means a 1,4-beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) that catalyzes the endo-hydrolysis of 1,4-beta-D-xylosidic bonds in xylans. For the purposes of the present invention, xylanase activity is determined with AZCL-arabinoxylan 0.2% as a substrate in TRITON X-100 0.01% and 200 mM sodium phosphate buffer, pH 6 at 37 ° C. One unit of xylanase activity is defined as 1.0 μmol of azurine produced per minute at 37 ° C, pH 6, from 0.2% AZCL-arabinoxylan as a substrate in 200 mM sodium phosphate buffer, pH 6. DETAILED DESCRIPTION OF THE INVENTION
[00092] The present invention relates to enzymatic compositions, comprising (i) a cellobiohydrolase I from Aspergillus fumigatus ', (ii) a cellobiohydrolase II from Aspergillus fumigatus', (iii) a beta-glucosidase from Aspergillus fumigatus or a variant thereof ; and (iv) a GH61 polypeptide from Penicilllium sp. (emersonii) having better cellulolytic activity; or similar counterparts.
[00093] In one aspect, the enzyme compositions further comprise an Aspergillus fumigatus xylanase, a Aspergillus fumigatus beta-xylidasidase, or a combination thereof; or their counterparts.
[00094] The enzyme compositions of the present invention are more efficient at destroying cellulosic material than a cellulolytic enzyme composition produced by T. reesei. Enzymatic compositions
[00095] In the present invention, any Aspergillus fumigatus cellobiohydrolase I, Aspergillus fumigatus cellobiohydrolase II, an Aspergillus fumigatus beta-glucosidase or variant thereof, Penicillium sp. (emersonií) polypeptide GH61 having better cellulolytic activity, Aspergillus fumigatus xylanase, or Aspergillus fumigatus beta-xilosidase, or homologues thereof, can be used.
[00096] In one aspect, Aspergillus fumigatus cellobiohydrolase I or a homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 1 or the full length complement the same.
[00097] In another aspect, the cellobiohydrolase II of Aspergillus fumigatus or a homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 3 or the full size complement the same.
[00098] In another aspect, the beta-glucosidase of Aspergillus fumigatus or a homologue thereof is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (ii) a beta-glucosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 6; (iii) a beta-glucosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 5; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 5 or the size complement total of it.
[00099] In another aspect, the GH61 polypeptide from Penicillium sp. (emersonii) having better cellulolytic activity or a homologue thereof is selected from the group consisting of: (i) a GH61 polypeptide having better cellulolytic activity that comprises or consists of the mature polypeptide of SEQ ID NO: 8; (ii) a GH61 polypeptide having better cellulolytic activity that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 8; (iii) a GH61 polypeptide having better cellulolytic activity encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence encoding the polypeptide mature of SEQ ID NO: 7; and (iv) a GH61 polypeptide having better cellulolytic activity encoded by a polynucleotide that hybridizes under at least high severity conditions, for example, very high severity conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 7 or the full size complement of the same.
[000100] In another aspect, the xylanase of Aspergillus fumigatus or a homologue thereof is selected from the group consisting of: (i) a xylanase that comprises or consists of the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14; (ii) a xylanase comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12 , or SEQ ID NO: 14; (iii) a xylanase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID NO polypeptide : 9, SEQ ID NO: 11, or SEQ ID NO: 13; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least high stringency conditions, for example, very high stringency conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13; or the full size complement of it.
[000101] In another aspect, the beta-xylosidase of Aspergillus fumigatus or a homologue thereof is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) a beta-xylosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 16; (iii) a beta-xylosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 15; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes in at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 15 or the size complement total of it.
[000102] The polynucleotide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15, or a subsequence thereof, as well as the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, or 16, or a fragment thereof, can be used to determine the nucleic acid probes to identify and clone the DNA encoding the enzymes according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene in them. Such probes can be considerably smaller than the complete sequence, but can be at least 15, for example, at least 25, at least 35, or at least 70 nucleotides in size. Preferably, the nucleic acid probe has at least 100 nucleotides in size, for example, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in size. Both DNA and RNA probes can be used. The probes are typically labeled to detect the corresponding gene (for example, with 32P, 3H, 33S, biotin, or avidin). Such probes are included by the present invention.
[000103] A genomic DNA or cDNA library can be selected for DNA that hybridizes to the previously described probes and encodes an enzyme. Genomic or other DNA can be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. The DNA from the libraries or the separated DNA can be transferred and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that hybridizes to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15, or a subsequence thereof, the carrier material is used in a Southern blot.
[000104] For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe that corresponds to (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15; (ii) the sequence encoding the mature polypeptide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15, or 21; (iii) the cDNA sequence thereof; (iv) the complement of its total size; or (v) a subsequence thereof; in very low to very high severity conditions. The molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film and any other means of detection known in the art.
[000105] In one aspect, the nucleic acid probe is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, or 15, or the sequence encoding the mature polypeptide thereof. In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, or 16; the mature polypeptide thereof; or a fragment of it.
[000106] The techniques used to isolate or clone a polynucleotide are known in the art and include isolation from genomic or cDNA, or a combination thereof. Cloning of polynucleotides from genomic DNA can be performed, for example, using the well-known polymerase chain reaction (PCR) or antibody selection from expression libraries to detect cloned DNA fragments with similar structural characteristics. See, for example, Innis et dl., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures, such as ligase chain reaction (LCR), ligation-activated transcription (LAT) and polynucleotide-based amplification (NASBA) can be used. Polynucleotides can be an allelic species or variant of the polynucleotide region that encodes the polypeptide.
[000107] A genetically modified protein variant of an earlier enzyme (or protein) can also be used.
[000108] In one aspect, the variant is a beta-glucosidase variant of Aspergillus fumigatus. In another aspect, the beta-glucosidase variant of A. fumigatus comprises a substitution in one or more (several) positions corresponding to positions 100, 283, 456, and 512 of SEQ ID NO: 6, in which the variant has activity of beta-glucosidase.
[000109] In one embodiment, the variant has sequence identity of at least 80%, for example, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86 %, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96 %, at least 97%, at least 98%, at least 99%, but less than 100%, with the parental beta-glucosidase amino acid sequence.
[000110] In another embodiment, the variant has at least 80%, for example, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least at least 97%, at least 98%, at least 99%, but less than 100%, of sequence identity with the mature polypeptide of SEQ ID NO: 6.
[000111] For purposes of the present invention, the mature polypeptide disclosed in SEQ ID NO: 6 is used to determine the corresponding amino acid residue in another beta-glucosidase. The amino acid sequence of another beta-glucosidase is aligned with the mature polypeptide disclosed in SEQ ID NO: 6, and based on the alignment, the amino acid position number that corresponds to any amino acid residue in the mature polypeptide revealed in SEQ ID NO: 6 is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite , Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or higher. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the replacement matrix EBLOSUM62 (EMBOSS version of BLOSUM62). The identification of the corresponding amino acid residue in another beta-glucosidase can be determined by aligning multiple polypeptide sequences using various computer programs including, but not limited to, MUSCLE (multiple expectation log comparison; version 3.5 or higher; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6,857 or higher; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methodos in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS EMMA which employs ClustalW (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 46734680), using their respective standard parameters.
[000112] For an amino acid substitution, the following nomenclature is used: original amino acid, position, substituted amino acid. In this way, the replacement of threonine in position 226 with alanine is determined “Thr226Ala” or “T226A”. Multiple mutations are separated by addition marks (“+”), for example, “Gly205Arg + Ser411Phe” or “G205R + S411F”, represented substitutions at positions 205 and 411 of glycine (G) with arginine (R) and serine ( S) by phenylalanine (F), respectively.
[000113] In one aspect, a variant comprises a substitution in one or more (several) positions that correspond to positions 100, 283, 456, and 512. In another aspect, a variant comprises a substitution in positions that correspond to any of the positions 100, 283, 456, and 512. In another aspect, a variant comprises a substitution in three positions corresponding to any of positions 100, 283, 456, and 512. In another aspect, a variant comprises a substitution in each position corresponding to positions 100, 283, 456, and 512.
[000114] In another aspect, the variant comprises or consists of a substitution in a position that corresponds to position 100. In another aspect, the amino acid in a position that corresponds to position 100 is replaced by Ala, Arg, Asn, Asp , Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Asp. In another aspect, the variant comprises or consists of the F100D substitution of the mature polypeptide of SEQ ID NO: 6.
[000115] In another aspect, the variant comprises or consists of a substitution in a position that corresponds to position 283. In another aspect, the amino acid in a position that corresponds to position 283 is replaced by Ala, Arg, Asn, Asp , Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vai, preferably by Gly In another aspect, the variant comprises or consists of the S283G substitution of the mature polypeptide of SEQ ID NO: 6.
[000116] In another aspect, the variant comprises or consists of a substitution in a position that corresponds to position 456. In another aspect, the amino acid in a position that corresponds to position 456 is replaced by Ala, Arg, Asn, Asp , Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Glu. In another aspect, the variant comprises or consists of the N456E substitution of the mature polypeptide of SEQ ID NO: 6.
[000117] In another aspect, the variant comprises or consists of a substitution in a position that corresponds to position 512. In another aspect, the amino acid in a position that corresponds to position 512 is replaced by Ala, Arg, Asn, Asp , Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably by Tyr. In another aspect, the variant comprises or consists of the F512Y substitution of the mature polypeptide of SEQ ID NO: 6.
[000118] In another aspect, the variant comprises or consists of a substitution in positions corresponding to positions 100 and 283, such as those described above.
[000119] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 100 and 456, such as those described above.
[000120] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 100 and 512, such as those described above.
[000121] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 283 and 456, such as those described above.
[000122] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 283 and 512, such as those described above.
[000123] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 456 and 512, such as those described above.
[000124] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 100, 283, and 456, such as those described above.
[000125] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 100, 283, and 512, such as those described above.
[000126] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 100, 456, and 512, such as those described above.
[000127] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 283, 456, and 512, such as those described above.
[000128] In another aspect, the variant comprises or consists of substitutions in positions corresponding to positions 100, 283, 456, and 512, such as those described above.
[000129] In another aspect, the variant comprises or consists of one or more (several) substitutions selected from the group consisting of G142S, Q183R, H266Q, and D703G.
[000130] In another aspect, the variant comprises or consists of the F100D + S283G substitutions of the mature polypeptide of SEQ ID NO: 6.
[000131] In another aspect, the variant comprises or consists of the F100D + N456E substitutions of the mature polypeptide of SEQ ID NO: 6.
[000132] In another aspect, the variant comprises or consists of the F100D + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000133] In another aspect, the variant comprises or consists of the S283G + N456E substitutions of the mature polypeptide of SEQ ID NO: 6.
[000134] In another aspect, the variant comprises or consists of the S283G + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000135] In another aspect, the variant comprises or consists of the N456E + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000136] In another aspect, the variant comprises or consists of the F100D + S283G + N456E substitutions of the mature polypeptide of SEQ ID NO: 6.
[000137] In another aspect, the variant comprises or consists of the F100D + S283G + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000138] In another aspect, the variant comprises or consists of the F100D + N456E + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000139] In another aspect, the variant comprises or consists of the S283G + N456E + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000140] In another aspect, the variant comprises or consists of the F100D + S283G + N456E + F512Y substitutions of the mature polypeptide of SEQ ID NO: 6.
[000141] Variants can consist of 720 to 863 amino acids, for example, 720 to 739, 740 to 759, 760 to 779, 780 to 799, 800 to 819, 820 to 839, and 840 to 863 amino acids.
[000142] The variants may additionally comprise a change in one or more (several) other positions.
[000143] The enzyme composition may additionally comprise one or more (for example, several) enzymes selected from the group consisting of a cellulase, a GH61 polypeptide having better cellulolytic activity, a hemicellulase, an esterase, an expansin, a laccase, an enzyme ligninolytic, a pectinase, a peroxidase, a protease, and a swolenin. In another aspect, cellulase is preferably one or more (for example, several) enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase and a beta-glucosidase. In another aspect, hemicellulase is preferably one or more (for example, several) enzymes selected from the group consisting of an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase , a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase and a xylosidase.
[000144] One or more (for example, several) of the enzymes can be wild type proteins, recombinant proteins, or a combination of wild type proteins and recombinant proteins. For example, one or more (for example, several) enzymes can be natural proteins of a cell, which is used as a host cell to recombinantly express the enzyme composition.
[000145] Examples of bacterial endoglucanases that can be used in the processes of the present invention include, but are not limited to, an Acidothermus cellulolyticus endoglucanase (WO 91/05039; WO 93/15186; US patent 5,275,944; WO 96/02551; US patent 5,536,655, WO 00/70031, WO 05/093050); endoglucanase III d e Thermobifida fusca (WO 05/093050) and endoglucanase V from Thermobifida fusca (WO 05/093050).
[000146] Examples of fungal endoglucanases that can be used in the present invention include, but are not limited to, a Trichoderma reesei endoglucanase I (Penttila et al., 1986, Gene 45: 253-263, Trichoderma reesei Cel7B endoglucanase (access to GENBANK ™ number Ml 5665), Trichoderma reesei endoglucanase II (Saloheimo, et al., 1988, Gene 63: 11-22), Trichoderma reesei Cel5A endoglucanase II (access to GENBANK ™ number Ml9373), Trichoderma reesei endoglucanase III ( Okada et al., 1988, Appl. Environ. Microbiol. 64: 555-563, access to GENBANK ™ number AB003694), Trichoderma reesei endoglucanase V (Saloheimo et al., 1994, Molecular Microbiology 13: 219-228, access to GENBANK ™ number Z33381), Aspergillus aculeatus endoglucanase (Ooi et al., 1990, Nucleic Acids Research 18: 5884), Aspergillus kawachii endoglucanases (Sakamoto et al., 1995, Current Genetics 27: 435-439), Erwinia endoglucanase carotovara (Saarilahti et al., 1990, Gene 90: 9-14), Fusari endoglucanase an oxysporum (access to GENBANK ™ number L29381), endoglucanase from Humicola grisea var. thermoidea (access to GENBANK ™ number AB003107), endoglucanases of Melanocarpus albomyces (access to GENBANK ™ number MAL515703), endoglucanases of Neurospora crassa (access to GENBANK ™ number XM_324477), endoglucanase V of Humicolahys.6 basidiomycete CBS 495.95, endoglucanases of CBS 494.95, endoglucanases of Thielavia terrestris NRRL 8126 CEL6B, endoglucanases of Thielavia terrestris NRRL 8126 CEL6C, endoglucanases of Thielavia terrestris NRRL 8126 CEL7C, 7 TER6avia CEL7C endoglucanases from Cladorrhinum foecundissimum ATCC 62373 CEL7A and endoglucanase from Trichoderma reesei strain number VTT-D-80133 (access to GENBANK ™ number M15665).
[000147] In one aspect, the enzyme composition further comprises a Trichoderma endoglucanase I. In another aspect, the enzyme composition further comprises a Trichoderma reesei endoglucanase I. In another aspect, the enzyme composition further comprises a Trichoderma reesei Cel7B endoglucanase I (GENBANK ™ accession number M5665). In another aspect, Trichoderma reesei endoglucanase I is natural to the host cell. In another aspect, Trichoderma reesei endoglucanase I is the mature polypeptide of SEQ ID NO: 90.
[000148] In another aspect, the enzyme composition further comprises a Trichoderma endoglucanase II. In another aspect, the enzyme composition further comprises a Trichoderma reesei endoglucanase II. In another aspect, the enzyme composition further comprises an endoglucanase II of Trichoderma reesei Cel5A (GENBANK ™ accession number M9373). In another aspect, Trichoderma reesei endoglucanase II is natural to the host cell. In another aspect, Trichoderma reesei endoglucanase I is the mature polypeptide of SEQ ID NO: 92.
[000149] The compositions can be prepared according to methods known in the art and can be in the form of a liquid or a dry composition. The compositions can be stabilized according to methods known in the art.
[000150] The enzyme composition can also be a fermentation broth formulation or a cell composition.
[000151] The term "fermentation broth", as used herein, refers to a preparation produced by cell fermentation that undergoes minimal or no purification and / or recovery. For example, fermentation broths are produced when microbial cultures are grown in saturation, incubated under conditions of carbon limitation, to allow protein synthesis (for example, expression of enzymes by host cells) and secretion in a culture medium. cells. The fermentation broth may contain unfractionated or fractionated contents, from fermentation materials derived at the end of fermentation. Typically, the fermentation broth is unfractionated and comprises the culture medium used and the cell debris present after the microbial cells (for example, filamentous fungus cells) are removed, for example, by centrifugation. In some embodiments, the fermentation broth contains used cell culture medium, extracellular enzymes and viable and / or non-viable microbial cells.
[000152] In one embodiment, the fermentation broth formulation and cellular compositions comprise a first organic acid component, comprising at least one 1-5 carbon organic acid and / or a salt thereof, and a second acid component organic comprising at least an organic acid of 6 or more carbons and / or a salt thereof. In a specific embodiment, the first component of organic acid is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the above, and the second component of organic acid is benzoic acid, cyclohexanecarboxylic acid , 4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.
[000153] In one aspect, the composition contains organic acid (s) and, optionally, contains dead cells and / or additional cell debris. In one embodiment, dead cells and / or cell debris are removed from a broth complete with dead cells to provide a composition that is free of these components.
[000154] Fermentation broth formulations or cell compositions may additionally comprise a conservate and / or antimicrobial agent (e.g., bacteriostatic) including, but not limited to, sorbitol, sodium chloride, potassium sorbate, and others known in the art.
[000155] The broth or complete composition of dead cells may contain the unfractionated contents of fermentation materials derived from the end of fermentation. Typically, the broth or complete composition of dead cells contains the culture medium used and the cell debris present after the microbial cells (for example, filamentous fungus cells) grow by saturation, are incubated under conditions of carbon limitation to allow synthesis protein (for example, expression of cellulase and / or glucosidase enzyme (s)). In some embodiments, the broth or complete composition of dead cells contains the culture medium used, extracellular enzymes and dead cells of filamentous fungus. In some embodiments, microbial cells present in the broth or complete composition of dead cells can be permeabilized and / or lysed using methods known in the art.
[000156] A complete cell composition or broth, as described herein, is typically a liquid, but may contain insoluble components, such as dead cells, cell debris, components of the culture medium, and / or insoluble enzyme (s) ( s). In some embodiments, insoluble components can be removed to provide a clear liquid composition.
[000157] The full-broth formulations and cellular compositions of the present invention can be produced by a method described in WO 90/15861 or WO 2010/096673. Host cell
[000158] The present invention also relates to host cells of recombinant filamentous fungi, comprising polynucleotides encoding (i) a cellobiohydrolase I of Aspergillus fumigatus ', (ii) a cellobiohydrolase II of Aspergillus fumigatus', (iii) a beta- glucosidase from Aspergillus fumigatus or a variant thereof; and (iv) a GH61 polypeptide from Pemcilllium sp. having better cellulolytic activity; or similar counterparts. The term "host cell" includes any progeny of a parental cell that is not identical to the parental cell, due to the mutations that occur during replication.
[000159] The host cell can be any filamentous fungus cell used in recombinant production of an enzyme or protein.
[000160] "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are generally characterized by a mycelium wall composed of chitin, cellulose, glycan, chitosan, mannan and other complex polysaccharides. Vegetative growth is by stretching hyphae and carbon catabolism is mandatory aerobic. On the contrary, the vegetative growth of yeasts, such as Saccharomyces cerevisiae, is by budding from a single-celled stem and the carbon catabolism can be fermentative.
[000161] The host cells of the filamentous fungus can be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Neocor, Mycelio, Mycelio, Mycelio Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma.
[000162] For example, the host cells of the filamentous fungus may be a cell of Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Ceriororisisis, Cerjorisisipisis, Ceri Ceriporiopsis pannocinta, rivulose Ceriporiopsis, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, lucknowense Chrysosporium, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum cinereus Coprinus, Coriolus hirsutus, Fusarium bactridioides, cerealis Fusarium, Fusarium crookwellense , Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium arium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotielusyon, terrestrial, terrestrial, terrarium , Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.
[000163] Fungal cells can be transformed by a process that involves the formation of protoplasts, transformation of protoplasts and regeneration of the cell wall in a manner known per se. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Know. USA 81: 1470-1474, and Christensen et al., 1988, Bio / Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147156, and WO 96/00787. Yeast can be transformed using the procedures described by Becker and Guarente, In Abelson, JN and Simon, MI, editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc. , New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
[000164] In one aspect, the filamentous fungus cell is any Trichoderma cell used in the recombinant production of an enzyme or protein. For example, the Trichoderma cell can be a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell. In another aspect, the Trichoderma cell is a Trichoderma harzianum cell. In another aspect, the Trichoderma cell is a Trichoderma koningii cell. In another aspect, the Trichoderma cell is a Trichoderma longibrachiatum cell. In another aspect, the Trichoderma cell is a Trichoderma reesei cell. In another aspect, the Trichoderma cell is a Trichoderma viride cell.
[000165] In another aspect, the Trichoderma reesei cell is Trichoderma reesei RutC30. In another aspect, the Trichoderma reesei cell is Trichoderma reesei TV10. In another aspect, the Trichoderma reesei cell is a mutant of Trichoderma reesei RutC30. In another aspect, the Trichoderma reesei cell is a mutant of Trichoderma reesei TV 10. In another aspect, the Trichoderma reesei cell is a morphological mutant of Trichoderma reesei. See, for example, WO 97/26330, which is incorporated herein by reference in its entirety.
[000166] The Trichoderma cell can be transformed by a process that involves the formation of protoplasts, transformation of protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transforming Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Know. USA 81: 1470-1474, and Christensen et al., 1988, Bio / Technology 6: 1419-1422.
[000167] One or more (for example, several) natural cellulase and / or hemicellulase genes can be inactivated in the Trichoderma host cell by interrupting or eliminating the genes, or a portion of them, which results in the mutant cell that produces less or none of the cellulase and / or hemicellulase than the parental cell, when grown under the same conditions. In one aspect, the one or more (for example, several) cellulase genes encode enzymes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II, beta-glucosidase, and swolenin. In another aspect, the one or more (for example, several) hemicellulase genes encode enzymes selected from the group consisting of xylanase I, xylanase II, xylanase III, and beta-xylosidase. In another aspect, the one or more (for example, several) hemicellulase genes encode enzymes selected from the group consisting of an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, an galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, and a mannosidase.
[000168] The mutant cell can be constructed by reducing or eliminating the expression of a polynucleotide encoding a Trichoderma cellulase or hemicellulase using methods well known in the art, for example, insertions, interruptions, substitutions or deletions. In a preferred aspect, the polynucleotide is inactivated. The polynucleotide to be modified or inactivated can be, for example, the coding region or a part of it essential for activity, or a regulatory element required for the expression of the coding region. An example of a regulatory or control sequence like this can be a promoter sequence or a functional part of it, that is, a part that is sufficient to affect the expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, a major sequence, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.
[000169] The modification or inactivation of the polynucleotide can be carried out by subjecting the mother cell to mutagenesis and selecting mutant cells in which the expression of the polynucleotide has been reduced or eliminated. Mutagenesis, which can be specific or random, can be performed, for example, by using a suitable physical or chemical mutagen, by using a suitable oligonucleotide, or by submitting the DNA sequence to PCR-generated mutagenesis. Furthermore, mutagenesis can be performed using any combination of these mutagens.
[000170] Examples of a physical or chemical mutagen suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulfonate (EMS), sodium bisulfite, formic acid and nucleotide analogs.
[000171] When such agents are used, mutagenesis is typically performed by incubating the mother cell to be mutagenized in the presence of the mutagen of choice under suitable conditions, and by screening and / or selecting mutant cells that exhibit reduced or no expression of the gene.
[000172] The modification or inactivation of the polynucleotide can also be carried out by inserting, replacing or eliminating one or more (for example, several) nucleotides in the gene, or a regulatory element required for its transcription or translation. For example, nucleotides can be inserted or removed in a way that results in the introduction of a stop codon, removal of the initial codon, or a change in the open reading frame. Such modification or inactivation can be carried out by site-directed mutagenesis or mutagenesis generated by PCR according to methods known in the art. Although the modification can initially be carried out in vivo, that is, directly in the cell expressing the polynucleotide to be modified, it is preferable that the modification is carried out in vitro in the manner exemplified below.
[000173] An example of a convenient way to eliminate or reduce the expression of a polynucleotide is based on techniques of gene replacement, gene deletion or gene disruption. For example, in the gene disruption method, a nucleic acid sequence that corresponds to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the mother cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that can be used for the selection of transformants in which the polynucleotide has been modified or destroyed. In one aspect, the polynucleotide is disrupted with a selectable marker such as those described herein.
[000174] The modification or inactivation of the polynucleotide can also be accomplished by inhibiting the expression of an enzyme encoded by the polynucleotide in a cell by administering to the cell or expressing in the cell a double-stranded RNA molecule (RNAds), in which the RNAds comprise a subsequence a polynucleotide that encodes the enzyme. In a preferred aspect, RNAds have about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in size.
[000175] RNAds are preferably a small interference RNA (RNAsi) or a micro RNA (RNAmi). In a preferred aspect, RNAds are small interfering RNAs to inhibit transcription. In another preferred aspect, RNAds are micro RNA to inhibit translation. In another aspect, double-stranded RNA molecules (RNAds) comprise a portion of the sequence encoding the mature polypeptide of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, and / or SEQ ID NO: 29 to inhibit polypeptide expression in a cell. Although the present invention is not limited by any particular mechanism of action, RNAds can enter a cell and cause degradation of a single-stranded RNA (ssRNA) of similar or identical sequences, including endogenous RNAms. When a cell is exposed to RNAds, the homologous gene's mRNA is selectively degraded by a process called interference RNA (RNAi).
[000176] RNAsds can be used in gene silencing to selectively degrade RNA using an RNAids of the present invention. The process can be practiced in vitro, ex vivo or in vivo. In one respect, RNAds molecules can be used to generate a loss-of-de fi nition mutation in a cell, organ or animal. Methods of preparing and using RNAd molecules to selectively degrade RNA are well known in the art; see, for example, U.S. patents 6,489,127, 6,506,559, 6,511,824 and 6,515,109.
[000177] In one aspect, Trichoderma cellobiohydrolase I or a homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 18; (iii) a cellobiohydrolase I encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 17; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 17 or the full length complement the same.
[000178] In another aspect, Trichoderma cellobiohydrolase II or a homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 20; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 20; (iii) a cellobiohydrolase II encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 19; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 19 or the full size complement the same.
[000179] In another aspect, Trichoderma beta-glucosidase or a homologue thereof is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 22; (ii) a beta-glucosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 22; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 21; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 21 or the size complement total of it.
[000180] In another aspect, Trichoderma xylanase or a homologue thereof is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 24, SEQ ID NO: 26 , or SEQ ID NO: 28; (ii) a xylanase comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 24, SEQ ID NO: 26 , or SEQ ID NO: 28; (iii) a xylanase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID NO polypeptide : 23, SEQ ID NO: 25, or SEQ ID NO: 27; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 23, SEQ ID NO: 25, or SEQ ID NO: 27; or the full size complement of it.
[000181] In another aspect, Trichoderma beta-xylosidase or a homologue thereof is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 30; (ii) a beta-xylosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 30; (iii) a beta-xylosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82 %, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature polypeptide of SEQ ID NO: 29; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 29 or the size complement total of it.
[000182] In one aspect, a Trichoderma cellobiohydrolase I gene is inactivated. In another aspect, a Trichoderma cellobiohydrolase II gene is inactivated. In another aspect, a beta-glucosidase gene from Trichoderma is inactivated. In another aspect, a Trichoderma xylanase gene is inactivated. In another aspect, a Trichoderma beta-xylosidase gene is inactivated.
[000183] In another aspect, a Trichoderma cellobiohydrolase I gene and a Trichoderma cellobiohydrolase II gene are inactivated.
[000184] In another aspect, two or more (for example, several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylidasidase are inactivated. In another aspect, three or more (for example, several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated. In another aspect, four or more (for example, several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated. In another aspect, five or more (for example, several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated. In another aspect, six or more (for example, several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated.
[000185] In another aspect, cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated.
[000186] In another aspect, one or more (for example, several) protease genes are inactivated. In another aspect, the one or more (for example, several) protease genes are subtilisin-like serine protease, aspartic protease, and trypsin-like serine protease genes, as described in WO 2011/075677, which is incorporated herein by the reference in its entirety. Nucleic acid constructs
[000187] Nucleic acid constructs comprising a polynucleotide that encodes an enzyme or protein can be constructed by operably linking one or more (for example, several) control sequences to the polynucleotide to direct expression of the coding sequence in a filamentous fungus host cell, under conditions compatible with the control sequences. The manipulation of the polynucleotide before insertion into a vector may be desirable or necessary, depending on the expression vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.
[000188] The control sequence can be a promoter, a polynucleotide that is recognized by a filamentous fungus host cell for the expression of a polynucleotide that encodes an enzyme or protein. The promoter contains transcriptional control sequences that mediate polypeptide expression. The promoter can be any polynucleotide that shows transcriptional activity in the host cell, including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides that are both homologous and heterologous to the host cell.
[000189] Examples of promoters suitable for directing the transcription of nucleic acid constructs in filamentous fungus host cells are promoters obtained from the genes for Aspergillus nidulans acetamidase, neutral Aspergillus niger alpha-amylase, Aspergillus stable acid amylase niger, Aspergillus niger glucoamylase or Aspergillus awamori (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae isomerase phosphate triose, Fusarium amyloxyporin 7 proteases (778) (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Celobiohydrolase I from Trichoderma reesei, cellobiohydrolase II from Trichoderma reesei, endoglucanase I from Trichoderma reesei, endoglucanase II from Trichoderma reesei, endoglucanase Trichoderma reesei III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase beta, and Trichoderma reesei translation factor as well - tpi (a modified promoter from an Aspergillus neutral alpha-amylase gene, in which the untranslated main part has been replaced by an untranslated main part, from an Aspergillus' phosphate isomerase triose gene, the non-limiting examples include promoters modified from a neutral alpha-amylase gene from Aspergillus niger, where the main untranslated part has been replaced by an untranslated main part of a triose phosphate isomerase gene from Aspergillus nidulans or Aspergillus oryzae); and mutant, truncated and hybrid promoters thereof. Other promoters are described in U.S. Patent 6,011,147, which is incorporated herein in its entirety.
[000190] The control sequence can also be a transcription terminator, which is recognized by a filamentous fungus host cell to terminate transcription. The terminator is operably linked to the 3 'end of the polynucleotide that encodes the polypeptide. Any terminator that is functional in the host cell can be used in the present invention.
[000191] Preferred terminators for filamentous fungus host cells are obtained from Aspergillus nidulans anthranilate synthase genes, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, proteaseys type tripinume, fusarium proteaseys type tripinume beta-glucosidase from Trichoderma reesei, cellobiohydrolase I from Trichoderma reesei, cellobiohydrolase II from Trichoderma reesei, endoglucanase I from Trichoderma reesei, endoglucanase II from Trichoderma reesei, endoglucanase III from Trichoderma reesei, endoglucanase trichoderma reesei, endoglucanase x Trichoderma reesei II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase and translation elongation factor of Trichoderma reesei.
[000192] The control sequence can also be a major region, an untranslated region of an mRNA that is important for translation by a filamentous fungus host cell. The main part is operably linked to the 5 'end of the polynucleotide that encodes the polypeptide. Any major part that is functional in the host cell can be used.
[000193] The preferred main parts for filamentous fungus host cells are obtained from the genes for TAKA amylase from Aspergillus oryzae and triose phosphate isomerase from Aspergillus nidulans.
[000194] The control sequence can also be a polyadenylation sequence, a sequence operably linked to the 3 'termination of the polynucleotide and, when transcribed, is recognized by a filamentous fungus host cell as a signal to add polyadenosine residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell can be used.
[000195] The preferred polyadenylation sequences for the host cells of filamentous fungus are obtained from the genes for anthranilate synthase of Aspergillus nidulans, glucoamylase of Aspergillus niger, alpha-glucosidase of Aspergillus niger, TAKA amylase of Aspergillus oryzae protease, protease type of trypsinease oryzae protease Fusarium oxysporum, cellobiohydrolase I of Trichoderma reesei, cellobiohydrolase II of Trichoderma reesei, and endoglucanase V of Trichoderma reesei.
[000196] The control sequence can also be a region that encodes a signal peptide, that encodes a signal peptide attached to the N-terminus of a polypeptide, and directs the polypeptide in the cell's secretion pathway. The 5 'end of the polynucleotide coding sequence can intrinsically contain a naturally encoding signal peptide sequence in the open reading frame, with the segment of the coding sequence encoding the polypeptide. Alternatively, the 5 'end of the coding sequence may contain a coding signal peptide sequence that is foreign to the coding sequence. A foreign coding signal peptide sequence may be required where the coding sequence does not naturally contain a coding signal peptide sequence. Alternatively, a foreign signal peptide coding sequence can simply replace the natural signal peptide coding sequence in order to improve the secretion of the polypeptide. However, any signal encoding peptide sequence that directs the expressed polypeptide into the secretory pathway of a host cell can be used.
[000197] The efficient peptide signal coding sequences for filamentous fungus host cells are the signal peptide coding sequences obtained from the genes for neutral amylase from Aspergillus niger, Aspergillus niger glucoamylase, TAKA amylase from Aspergillus oryzae, Humicola insolens cellulase, Humicola insolens, cellulase from Humicola insolens, V of Humicola insolens, Humicola lanuginosa lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma endese and endoglucanase reese, Trichoderma reesei, Trichoderma reesei Trichoderma reesei.
[000198] The control sequence can also be a coding propeptide sequence that encodes a pro-peptide positioned at the N-terminus of a polypeptide. The resulting polypeptide is known as a pro-enzyme or pro-polypeptide (or a zymogen in some cases). A pro polypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the pro-peptide from the pro polypeptide. The sequence of the pro-peptide codificate can be obtained from the laccase genes of Myceliophthora thermophila (WO 95/33836) and Rhizomucor miehei aspartic proteinase.
[000199] Where both the signal peptide and the sequence of propeptides are present, the pro-peptide sequence is positioned close to the N termination of a polypeptide, and the signal peptide sequence is positioned close to the N termination of the pro sequence -peptide.
[000200] It may also be desirable to add regulatory sequences that regulate the expression of the polypeptide in relation to the growth of filamentous fungus host cells. Examples of regulatory sequences are those that cause expression of the gene to be activated and deactivated in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory sequences include the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reichese cellobiohydrolase II promoter. Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene, which is amplified in the presence of methotrexate, and metallothionein genes, which are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide can be operably linked in the regulatory sequence. Expression Vectors
[000201] Recombinant expression vectors can be constructed comprising a polynucleotide that encodes an Aspergillus fumigatus enzyme or protein, a promoter, a terminator, and transcriptional and translational stop signals. The various nucleotide and control sequences can be joined to produce a recombinant expression vector, which can include one or more (for example, several) convenient restriction sites to allow insertion or replacement of the polynucleotide encoding the polypeptide at all sites . Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector, such that the coding sequence is operably linked with the appropriate control sequences for expression.
[000202] The recombinant expression vector can be any vector (for example, a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can result in the expression of the polynucleotide. The choice of the vector will typically depend on the vector's compatibility with the host cell into which the vector will be introduced. The vector can be a closed linear or circular plasmid.
[000203] The vector can be a vector that replicates autonomously, that is, a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, for example, a plasmid, an extrachromosomal element, a minichromosome, or a artificial chromosome. The vector can contain any means to guarantee self-replication. Alternatively, the vector can be one that, when introduced into the host cell, is integrated into the genome and replicated along with the chromosome (s) into which it has been integrated. In addition, a single vector, or plasmid, or two or more vectors or plasmids that together contain the total DNA to be introduced into the host cell's genome, or a transposon, can be used.
[000204] The vector preferably contains one or more (for example, several) selectable markers that allow easy selection of transformed, transfected, transduced or similar cells. A selectable marker is a product of the gene that provides biocidal or viral resistance, resistance to heavy metals, prototrophy to auxotrophic and the like.
[000205] Examples of selectable markers for use in a filamentous fungus host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosylaminoimidazole synthase), amdS (acetamidase), argB (omitine carbamoyl) acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (adenyl transferase sulfate), and trpC (anthranylate synthase), as well as their equivalents. The amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and a bar gene of Streptomyces hygroscopicus are preferred for use in an Aspergillus cell. The genes adeA, adeB, amdS, hph, and pyrG genes are preferred for use in a Trichoderma cell. Examples of selectable bacterial markers are markers that confer resistance to antibiotics, such as resistance to ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline.
[000206] The selectable marker can be a dual selectable marker system as described in WO 2010/039889 A2, which is incorporated herein by the reference in its entirety. In one aspect, the selectable marker is a dual selectable marker system hph-tk.
[000207] The vector preferably contains an element (s) that allows the integration of the vector into the genome of the host cell or the autonomous replication of the vector in the cell independent of the genome.
[000208] For integration into the host cell genome, the vector may depend on the polynucleotide sequence encoding the polypeptide, or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides to direct integration by homologous recombination into the host cell genome at an exact location (s) on the chromosome (s). To increase the likelihood of integration in a precise location, the integrational elements may contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs and 800 to 10,000 base pairs, which have a high degree of sequence identity with the corresponding target sequence to improve the likelihood of homologous recombination. The integrational elements can be any sequence that is homologous to the target sequence in the host cell genome. Furthermore, the integrating elements can be non-coding or coding polynucleotides. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.
[000209] Xxx For autonomous replication, the vector may additionally comprise a source of replication that enables the vector to replicate autonomously in a Trichoderma host cell. The origin of replication can be any replicator plasmid that mediates autonomous replication that functions in a cell. The term "origin of replication" or "replicator plasmid" means a polynucleotide that enables a plasmid or vector to replicate in vivo.
[000210] Examples of origins of replication used in a Trichoderma host cell are AMAI and ANSI (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175 WO 00/24883). The isolation of the AMAI gene and the construction of plasmids or vectors comprising the gene can be carried out according to the methods disclosed in WO 00/24883.
[000211] More than one copy of a polynucleotide can be inserted into a Trichoderma host cell to increase the production of a polypeptide. An increase in the number of copies of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the genome of the host cell, or by including a selectable marker gene amplifiable with the polynucleotide, where cells containing amplified copies of the selectable marker gene and, through in addition, additional copies of the polynucleotide can be selected by culturing the cells in the presence of the appropriate selectable agent.
[000212] The procedures used to link the elements described above to construct the recombinant expression vectors are well known to those skilled in the art (see, for example, Sambrook et al., 1989, supra). Production Methods
[000213] The present invention also relates to methods of producing an enzyme composition, comprising: (a) cultivating a filamentous fungus host cell of the present invention under conditions that lead to the production of the enzyme composition; and optionally (b) recovering the enzyme composition.
[000214] Filamentous fungus host cells are grown in a nutrient medium suitable for the production of the enzymatic composition using methods known in the art. For example, the cell can be grown by shaking flask cultivation, or small or large scale fermentation (including continuous, batch, fed batch, or solid fermentation) in laboratory or industrial fermenters, in a medium and suitable conditions that allow enzymes to be expressed and / or isolated. Cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers, or can be prepared according to published compositions (for example, in catalogs of the American Type Culture Collection).
[000215] Enzymes can be detected using methods known in the art, which are specific to the enzyme. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine activity.
[000216] Enzymes can be recovered using methods known in the art. For example, the enzyme can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. In one aspect, the complete fermentation broth is recovered.
[000217] Enzymes can be purified by a variety of procedures known in the art including, but not limited to, chromatography (eg, ion exchange, affinity, hydrophobic, chromato-focusing, and size exclusion), electrophoretic procedures (eg, focusing preparatory isoelectric), differential solubility (for example, precipitation with ammonium sulfate), SDS-PAGE, or extraction (see, for example, Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain the polypeptides substantially pure. Uses
[000218] The present invention also relates to the following processes for using an enzyme composition of the present invention.
[000219] The present invention also relates to processes for degrading a cellulosic material, comprising: treating the cellulosic material with an enzymatic composition of the present invention. In one aspect, the processes further comprise recovering the degraded or converted cellulosic material. Soluble products of degradation or conversion of cellulosic material can be separated from insoluble cellulosic material using a method known in the art such as, for example, centrifugation, filtration or gravity establishment.
[000220] The present invention also relates to processes for synthesizing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzymatic composition of the present invention; (b) fermenting the saccharified cellulosic material with one or more (for example, several) fermenting microorganisms to synthesize the fermentation product; and (c) recovering the fermentation product from the fermentation.
[000221] The present invention also relates to the processes of fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more (for example, several) fermenting microorganisms, wherein the cellulosic material is saccharified with an enzymatic composition of the present invention. In one aspect, the fermentation of the cellulosic material synthesizes a fermentation product. In another aspect, the processes further comprise recovering the fermentation product from the fermentation.
[000222] The processes of the present invention can be used to saccharize cellulosic material into fermentable sugars, and to convert fermentable sugars into many usable fermentation products, for example fuel, potable ethanol and / or platform chemicals (for example , acids, alcohols, ketones, gases and the like). The production of a desired fermentation product from cellulosic material typically involves pretreatment, enzymatic hydrolysis (saccharification) and fermentation.
[000223] The processing of cellulosic material according to the present invention, can be carried out using conventional methods in the art. Furthermore, the processes of the present invention can be implemented using any conventional biomass processing apparatus configured to operate in accordance with the invention.
[000224] Hydrolysis (saccharification) and fermentation, separate or simultaneous, include, but are not limited to, separate hydrolysis and fermentation (SHF); simultaneous saccharification and fermentation (SSF); simultaneous saccharification and co-fermentation (SSCF); hybrid hydrolysis and fermentation (HHF); separate hydrolysis and co-fermentation (SHCF); hybrid hydrolysis and co-fermentation (HHCF) and direct microbial conversion (DMC), sometimes also called consolidated bioprocessing (CBP). SHF uses separate process steps to enzymatically hydrolyze cellulosic material into fermentable sugars, for example, glucose, cellobiose and pentose monomers, and then ferment fermentable sugars in ethanol. In SSF, the enzymatic hydrolysis of cellulosic material and the fermentation of sugars in ethanol are combined in one step (Philippidis, GP, 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed., Taylor & Francis, Washington, DC, 179-212). SSCF involves the co-fermentation of multiple sugars (Sheehan, J. and Himmel, M., 1999, Enzymes, energy and the environment: A strategic perspective on the US Department of Energy's research and development activities for bioethanol, Biotechnol. Prog. 15 : 817-827). HHF involves a separate hydrolysis step and, in addition, a simultaneous saccharification and hydrolysis step that can be performed in the same reactor. The steps in an HHF process can be carried out at different temperatures, that is, enzymatic saccharification at high temperature followed by SSF at a temperature lower than the fermentation strain can tolerate. DMC combines all three processes (production, hydrolysis and enzymatic fermentation) in one or more (for example, several) steps, where the same organism is used to produce the enzymes for converting cellulosic material into fermentable sugars and to convert sugars fermentable in a final product (Lynd, LR, Weimer, PJ, van Zyl, WH, and Pretorius, IS, 2002, Microbial cellulose utilization: Fundamentals and biotechnology, Microbiol. Mol. Biol. Reviews 66: 506-577). It is understood here that any method known in the art comprising pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof, can be used in the practice of the processes of the present invention.
[000225] A conventional apparatus may include a batch reactor agitated, a batch agitated reactor, a continuous flow agitated reactor with ultrafiltration and / or a continuous piston flow column reactor (Fernanda de Castilhos Corazza, Flávio Faria de Moraes, Gisella Maria Zanin and Ivo Neitzel, 2003, Optimal control in fed-batch reactor for the celobiose hydrolysis, Acta Scientiarum. Technology 25: 33-38; Gusakov, AV, and Sinitsyn, AP, 1985, Kinetics of the enzymatic hydrolysis of cellulose: 1. A mathematical model for a batch reactor process, Enz. Microb. Technol. 7: 346-352), a friction reactor (Ryu, SK, and Lee, JM, 1983, Bioconversion of waste cellulose using an attrition bioreactor , Biotechnol. Bioeng. 25: 53-65), or a reactor with intensive agitation induced by an electromagnetic field (Gusakov, AV, Sinitsyn, AP, Davydkin, IY, Davydkin, VY, Protas, OV, 1996, Enhancement of enzymatic cellulose hydrolysis using a novel type of bioreactor with intensive stirring induced by electromagnetic field, Appl. Biochem. Biotechnol. 56: 141-153). Additional types of reactors include: fluidized bed, upstream flow, immobilized and extruder reactors for hydrolysis and / or fermentation.
[000226] Pre-treatment. In the practice of the processes of the present invention, any pretreatment process known in the art can be used to disrupt plant cell wall components from cellulosic material (Chandra et al., 2007, Substrate pretreatment: The key to effective enzymatic hydrolysis enzyme of lignocellulosics Adv. Biochem. Engin./Biotechnol. 108: 67-93; Galbe and Zacchi, 2007, Pretreatment of lignocellulosic materials for efficient bioethanol production, Adv. Biochem. Engin./Biotechnol. 108: 41-65; Hendriks e Zeeman, 2009, Pretreatments to enhance the digestibility of lignocellulosic biomass, Bioresource Technol. 100: 10-18; Mosier et al., 2005, Features of promising technologies for pretreatment od lignocellulosic biomass, Bioresource Technol. 96: 673-686; Taherzadeh e Karimi, 2008, Pretreatment of lignocellulosic wastes to improve ethanol and biogas production: A review, Int. J. de Mol. Sci. 9: 1621-1651; Yang and Wyman, 2008, Pretreatment: The key to unlocking low-cost cell ulosic ethanol, Biofuels Bioproducts nd Biorefining-Biofpr. 2: 26-40).
[000227] Cellulosic material can also be subjected to particle size reduction, sieving, pre-soaking, humidification, washing and / or conditioning before pretreatment using methods known in the art.
[000228] Conventional pretreatments include, but are not limited to, steam pretreatment (with or without explosion), diluted acid pretreatment, hot water pretreatment, alkaline pretreatment, lime pretreatment , wet oxidation, wet explosion, ammonia fiber explosion, organosolv pretreatment and biological pretreatment. Additional pretreatments include percolation treatments with ammonia, ultrasound, electroporation, microwave, supercritical CO2, supercritical H2O, ozone, ionic liquid and gamma irradiation.
[000229] Cellulosic material can be pre-treated before hydrolysis and / or fermentation. Pre-treatment is preferably carried out before hydrolysis. Alternatively, pretreatment can be carried out simultaneously with enzymatic hydrolysis to release fermentable sugars, such as glucose, xylose and / or cellobiosis. In many cases, the pre-treatment step itself results in some conversion of biomass into fermentable sugars (even in the absence of enzymes).
[000230] Pre-treatment with steam. In the steam pretreatment, the cellulosic material is heated to break up the components of the cell walls of plants, including lignin, hemicellulose and cellulose, to take cellulose and other fractions, for example, hemicellulose, accessible to enzymes. The cellulosic material passes through a reaction vessel where the steam is injected to increase the temperature to the required temperature and pressure and is maintained there for the desired reaction time. Pre-treatment with steam is preferably carried out at 140-250 ° C, for example, 160-200 ° C or 170-190 ° C, where the ideal temperature range depends on the addition of a chemical catalyst. The residence time for pre-treatment with steam is preferably 1-60 minutes, for example, 1-30 minutes, 1-20 minutes, 3-12 minutes or 4-10 minutes, where the ideal residence time depends on the range temperature and the addition of a chemical catalyst. Pre-treatment with steam allows relatively high solid loads, in such a way that the cellulosic material is generally moist only during pre-treatment. Steam pretreatment is often combined with an explosive discharge of material after pretreatment, which is known as a steam explosion, that is, rapid burning at atmospheric pressure and turbulent flow of the material to increase the surface area accessible by fragmentation (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59: 618-628; US patent application 20020164730). During the steam pretreatment, the acetyl hemicellulose groups are cleaved and the resulting acid autocatalyzes the partial hydrolysis of hemicellulose into monosaccharides and oligosaccharides. Lignin is removed to a limited extent only.
[000231] Chemical pretreatment: The term "chemical treatment" refers to any chemical pretreatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin. Such a pretreatment can convert crystalline cellulose into amorphous cellulose. Examples of suitable chemical pretreatment processes include, for example, pretreatment with dilute acid, pretreatment with lime, wet oxidation, fiber burst with ammonia / freezing (AFEX), percolation with ionic liquid ammonia (APR) and pre-treatments with organosolv.
[000232] A catalyst, such as H2SO4 or SO2 (typically 0.3 to 5% w / w), is generally added to the steam pretreatment which decreases time and temperature, increases recovery and improves enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132: 496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116: 509-523; Sassner et al., 2006, Enzyme Microb. Technol. 39: 756-762). In the pre-treatment with diluted acid, the cellulosic material is mixed with the diluted acid, typically H2SO4, and water to form a sludge, heated by steam at the desired temperature, and after a residence time it is burned at atmospheric pressure. Pretreatment with dilute acid can be performed with numerous reactor designs, for example, piston flow reactors, counter current reactors, or agitated bed reactors against direct current (Duff and Murray, 1996, supra ', Schell et al., 2004, Bioresource Technol. 91: 179-188; Lee et al., 1999, Adv. Biochem. Eng. Biotechnol. 65: 93-115).
[000233] Various pretreatment methods in alkaline conditions can also be used. These alkaline pretreatments include, but are not limited to, sodium hydroxide, lime, wet oxidation, percolation with ammonia (APR), and fiber burst with ammonia / freezing (AFEX).
[000234] Pre-treatment with lime is carried out with calcium oxide or calcium hydroxide at temperatures of 85-150 ° C and residence time from 1 hour to several days (Wyman et al., 2005, Bioresource Technol. 96: 19591966; Mosier et al., 2005, Bioresource Technol. 96: 673-686). WO 2006/110891, WO 2006/110899, WO 2006/110900, and WO 2006/110901 disclose pretreatment methods using ammonia.
[000235] Wet oxidation is a thermal pretreatment typically carried out at 180-200 ° C for 5-15 minutes with the addition of an oxidizing agent, such as hydrogen peroxide or oxygen super pressure (Schmidt and Thomsen, 1998, Bioresource Technol. 64: 139-151; Palonen et al., 2004, Appl. Biochem. Biotechnol. 117: 1-17; Varga et al., 2004, Biotechnol. Bioeng. 88: 567-574; Martin et al., 2006, J. Chem. Technol. Biotechnol. 81: 1669-1677). Pre-treatment is preferably carried out on 1-40% dry material, for example, 2-30% dry material or 5-20% dry material, and often the initial pH is increased by the addition of alkali, such as carbonate sodium.
[000236] A modification of the pre-treatment method with wet oxidation, known as wet explosion (combination of wet oxidation and steam explosion), can handle dry material up to 30%. In the wet explosion, the oxidizing agent is introduced during the pre-treatment after a certain period of residence. The pre-treatment is then finished by burning at atmospheric pressure (WO 2006/032282).
[000237] The fiber explosion with ammonia (AFEX) involves treating the cellulosic material with liquid or gaseous ammonia at moderate temperatures, such as 90-150 ° C, and high pressure such as 17-20 bar for 5-10 minutes, where the content of the dry material can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98: 23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96: 219-231; Alizadeh et al., 2005, Appl. Biochem. Biotechnol. 121: 1133-1141; Teymouri et al., 2005, Bioresource Technol. 96: 2014-2018). During pretreatment with AFEX, cellulose and hemicellulose remain relatively intact. Lignin-carbohydrate complexes are cleaved.
[000238] Pretreatment with organosolv delignifies cellulosic material by extraction using aqueous ethanol (40-60% ethanol) at 160-200 ° C for 30-60 minutes (Pan et al., 2005, Biotechnol. Bioeng. 90: 473-481; Pan et al., 2006, Biotechnol. Bioeng. 94: 851-861; Kurabi et al., 2005, Appl. Biochem. Biotechnol. 121: 219-230). Sulfuric acid is generally added as a catalyst. In pre-treatment with organosolv, most of the hemicellulose and lignin is removed.
[000239] Other examples of suitable pretreatment methods are described by Schell et al., 2003, Appl. Biochem. and Biotechnol. 105-108, 6985, and Mosier et al., 2005, Bioresource Technology 96: 673-686, and U.S. published application 2002/0164730.
[000240] In one aspect, the chemical pretreatment is preferably carried out as a diluted acid treatment, and more preferably as a continuous diluted acid treatment. The acid is typically sulfuric acid, but other acids can also be used, such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride or mixtures thereof. Weak acid treatment is conducted in the pH range of preferably 1-5, for example, 1-4 or 1-2.5. In one aspect, the concentration of the acid is in the range of preferably 0.01 to 10% by weight of acid, for example, 0.05 to 5% by weight of acid or 0.1 to 2% by weight of acid. The acid is brought into contact with the cellulosic material and maintained at a temperature in the range of preferably 140-200 ° C, for example, 165-190 ° C, for periods ranging from 1 to 60 minutes.
[000241] In another aspect, pretreatment takes place in an aqueous sludge. In preferred aspects, the cellulosic material is present during pre-treatment in amounts preferably between 10-80% by weight, for example, 20-70% by weight or 30-60% by weight, such as around 40% by weight. Weight. The pre-treated cellulosic material can be unwashed or washed using any method known in the art, for example, washed with water.
[000242] Mechanical pretreatment or physical pretreatment: The term "mechanical pretreatment" or "physical pretreatment" refers to any pretreatment that promotes particle size reduction. For example, such pre-treatment can involve various types of crushing or grinding (for example, dry grinding, wet grinding, or vibrating ball grinding).
[000243] Cellulosic material can be pretreated both physically (mechanically) and chemically. The mechanical or physical pretreatment can be coupled with vapor / steam explosion, hydrothermolysis, weak or diluted acid treatment, high temperature, high pressure treatment, irradiation (for example, microwave irradiation), or combinations thereof . In one aspect, high pressure means pressure in the range of preferably about 100 to about 400 psi, for example, about 150 to about 250 psi. In another aspect, elevated temperature means temperatures in the range of about 100 to about 300 ° C, for example, about 140 to about 200 ° C. In a preferred aspect, mechanical or physical pretreatment is carried out in a batch process using a steam gun hydrolyzer system that uses high pressure and high temperature in the manner defined above, for example, a Sunds hydrolyzer available from Sunds Defibrator AB , Sweden. Chemical or physical pretreatments can be carried out sequentially or simultaneously, if desired.
[000244] Thus, in a preferred aspect, the cellulosic material is subjected to physical (mechanical) or chemical pre-treatment, or any combination thereof, to promote the separation and / or release of cellulose, hemicellulose and / or lignin.
[000245] Biological pretreatment: The term "biological pretreatment" refers to any biological pretreatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin from cellulosic material. Biological pretreatment techniques may involve applying microorganisms and / or enzymes that solubilize lignin (see, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, CE , ed., Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Physicochemical and biological treatments for enzymatic / microbial conversion of cellulosic biomass, Adv. Appl. Microbiol. 39: 295-333; McMillan, JD , 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, ME, Baker, JO, and Overend, RP, eds., ACS Symposium Series 566, American Chemical Society, Washington, DC, chapter 15 ; Gong, CS, Cao, NJ, Du, J., and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany , 65: 207-241; Olsson and Hahn-Hagerdal, 1996, Fermentation of lignocellulosic hydrolysates for ethanol production, Enz. Microb. Tech. 18: 312-331; and Vallander and Eriksson, 1990, Production of ethanol from material lignocelullosics: State of art, Adv. Biochem. Eng./Biotechnol. 42: 63-95).
[000246] Saccharification. In the hydrolysis stage, also known as saccharification, the cellulosic material, for example, pre-treated, is hydrolyzed to break down cellulose and / or hemicellulose into fermentable sugars, such as glucose, cellobiosis, xylose, xylulose, arabinose, mannose, galactose , and / or soluble oligosaccharides. Hydrolysis is carried out enzymatically by an enzymatic composition of the present invention.
[000247] Enzymatic hydrolysis is preferably carried out in a suitable aqueous environment, under conditions that can be easily determined by those skilled in the art. In one aspect, hydrolysis is carried out under conditions suitable for the activity of the enzyme (s), that is, ideal for the enzyme (s). Hydrolysis can be carried out as a continuous or batch fed process, where the cellulosic material is fed gradually, for example, to an enzyme containing hydrolysis solution.
[000248] Saccharification is performed in general in reactors or fermenters in agitated tanks under controlled conditions of pH, temperature and mixture. The suitable conditions of process time, temperature and pH can be easily determined by those skilled in the art. For example, saccharification can last up to 200 hours, but is typically performed for preferably about 12 to about 120 hours, for example, about 16 to about 72 hours or about 24 to about 48 hours. The temperature is preferably in the range of about 25 ° C to about 70 ° C, for example, about 30 ° C to about 65 ° C, about 40 ° C to about 60 ° C, or about 50 ° C to about 55 ° C. The pH is preferably in the range of about 3 to about 8, for example, about 3.5 to about 7, about 4 to about 6, or about 5.0 to about 5.5. The dry solids content is preferably in the range of about 5 to about 50% by weight, for example, about 10 to about 40% by weight or about 20 to about 30% by weight.
[000249] In the processes of the present invention, the enzyme composition of the present invention can be added before or during fermentation, for example, during saccharification or during or after the propagation of the fermenting microorganism (s).
[000250] The enzyme composition of the present invention can be in any form suitable for use, such as, for example, a crude fermentation broth with or without cells removed, a cell lysate with or without cell residues, a semi-purified enzymatic preparation or purified, or a Trichoderma host cell as a source of the enzymes. The enzyme composition can be a dry or granulated powder, a granulate that is not powdered, a liquid, a stabilized liquid, or a protected stabilized enzyme. Liquid enzyme preparations, for example, can be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and / or lactic acid or another organic acid according to the established processes.
[000251] The ideal amount of Aspergillus fumigatus cellulases or hemicellulase depends on several factors including, but not limited to, the mixture of cellulolytic and / or hemicellulolytic enzyme components, the cellulosic material, the cellulosic material concentration, the pre (s) -treatment (s) of the cellulosic material, temperature, time, pH, and inclusion of fermenting organism (for example, yeast for saccharification and simultaneous fermentation).
[000252] In one aspect, an efficient amount of cellulolytic or hemicellulolytic enzyme for cellulosic material is about 0.01 to about 50.0 mg, for example, about 0.01 to about 40 mg, about 0 , 01 to about 30 mg, about 0.01 to about 20 mg, about 0.01 to about 10 mg, about 0.01 to about 5 mg, about 0.025 to about 1.5 mg, about 0.05 to about 1.25 mg, about 0.075 to about 1.25 mg, about 0.1 to about 1.25 mg, about 0.15 to about 1.25 mg, or about 0.25 to about 1.0 mg per g of the cellulosic material.
[000253] In another aspect, the GH61 polypeptide having better cellulolytic activity is used in the presence of a divalent soluble activating metal cation according to WO 2008/151043, for example, manganese sulfate.
[000254] In another aspect, a GH61 polypeptide having better cellulolytic activity is used in the presence of a dioxy compound, a bicyclic compound, a heterocyclic compound, a nitrogen-containing compound, a quinone compound, a sulfur-containing compound, or a liquor obtained from a pre-treated cellulosic material, such as pre-treated corn residue (PCS).
[000255] The dioxy compound can include any suitable compound containing two or more oxygen atoms. In some respects, the dioxy compounds contain a substituted aryl fraction, as described herein. Dioxy compounds may comprise one or more (for example, several) hydroxyls and / or hydroxyl derivatives, but also include substituted aryl fractions that do not contain hydroxyl and hydroxyl derivatives. Non-limiting examples of dioxy compounds include pyrocatechol or catechol; caffeic acid; 3,4-dihydroxybenzoic acid; 4-tert-butyl-5-methoxy-1,2-benzenediol; pyrogallol; gallic acid; methyl-3,4,5-trihydroxybenzoate; 2,3,4-trihydroxybenzophenone; 2,6-dimethoxyphenol; synapinic acid; 3,5-dihydroxybenzoic acid; 4-chloro-1,2-benzenediol; 4-nitro-1,2-benzenediol; tannic acid; ethyl gaiato; methyl glycolate; dihydroxyfumaric acid; 2-butyn-1,4-diol; (crochonic acid; 1,3-propanediol; tartaric acid; 2,4-pentanediol; 3-ethioxy-1,2-propanediol; 2,4,4'-trihydroxybenzophenone; cis-2-butene-1,4-diol; 3,4-dihydroxy-3-cyclobutene-1,2-dione; dihydroxyacetone; acrolein acetal; methyl-4-hydroxybenzoate; 4-hydroxybenzoic acid and methyl-3,5-dimethoxy-4-hydroxybenzoate, or a salt or solvate of themselves.
[000256] The bicyclic compound can include any suitable substituted fused ring system, as described herein. The compounds may comprise one or more (for example, several) additional rings, and are not limited to a specific number of rings, unless otherwise stated. In one aspect, the bicyclic compound is a flavonoid. In another aspect, the bicyclic compound is an optionally substituted isoflavonoid. In another aspect, the bicyclic compound is an optionally substituted flavilium ion, such as an optionally substituted anthocyanidin or optionally substituted anthocyanin, or derivatives thereof. Non-limiting examples of bicyclic compounds include epicatechin; quercetin; myricetin; taxifoline; caempferol; morina; acacetin; naringenin; isoramnetine; apigenin; cyanidin; cyanine; curomanine; kerakyanine or a salt or solvate thereof.
[000257] The heterocyclic compound can be any suitable compound, such as an optionally substituted aromatic or non-aromatic ring comprising a heteroatom, in the manner described herein. In one aspect, the heterocyclic is a compound comprising an optionally substituted heterocycloalkyl fraction, or an optionally substituted heteroaryl fraction. In another aspect, the optionally substituted heterocycloalkyl fraction, or optionally substituted heteroaryl fraction, is an optionally substituted 5-element heterocycloalkyl or an optionally substituted 5-element heteroaryl fraction. In another aspect, the optionally substituted heterocycloalkyl or optionally substituted heteroaryl fraction is an optionally substituted fraction selected from pyrazolyl, furanyl, imidazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrrolyl, pyridyl, pyrimidyl, pyridazinyl, thiazolyl, pyridine, triazole, triazole, triazole , tianaftenila, carbazolila, benzimidazolila, benzothienila, benzofuranila, indolila, quinolinila, benzotriazolila, benzothiazolila, benzooxazolila, benzimidazolila, isoquinolinila, isoindolila, acridinila, benzoisazolila, pyrimidine, pyridine, pyridine, pyridine , piperidinyl, and oxepinyl. In another aspect, the optionally substituted heterocycloalkyl fraction, or optionally substituted heteroaryl fraction, is an optionally substituted furanyl. Non-limiting examples of heterocyclic compounds include (1,2-dihydroxyethyl) -3,4-dihydroxyfuran-2 (5H) -one; 4-hydroxy-5-methyl-3-furanone; 5-hydroxy-2 (5H) -furanone; [1,2-dihydroxyethyl] furan-2,3,4 (5H) -trione; α-hydroxy-butyrolactone; y-lactone ribonic; aldoexuronic acid y-lactone; δ-lactone gluconic acid; 4-hydroxycoumarin; dihydrobenzofuran; 5- (hydroxymethyl) fiirfural; furoin; 2 (5H) -furanone; 5,6-dihydro-2H-pyran-2-one; and 5,6-dihydro-4-hydroxy-6-methyl-2H-pyran-2-one; or a salt or solvate thereof.
[000258] The nitrogen-containing compound can be any suitable compound with one or more (for example, several) nitrogen atoms. In one aspect, the nitrogen-containing compound comprises an amine, imine, hydroxylamine or nitroxide fraction. Non-limiting examples of nitrogen-containing compounds include acetone oxime; violuric acid; pyridine-2-aldoxime; 2-aminophenol; 1,2-benzenediamine; 2,2,6,6-tetramethyl-1-piperidinyloxy; 5,6,7,8-tetrahydrobiopterin; 6,7-dimethyl-5,6,7,8-tetrahydropterin and maleamic acid; or a salt or solvate thereof.
[000259] The quinone compound can be any suitable compound that comprises a fraction of quinone in the manner described herein. Non-limiting examples of quinone compounds include 1,4-benzoquinone; 1,4- naphthoquinone; 2-hydroxy-1,4-naphthoquinone; 2,3-dimethoxy-5-methyl-1,4-benzoquinone or coenzyme Qo; 2,3,5,6-tetramethyl-1,4-benzoquinone or duroquinone; 1,4-dihydroxyanthraquinone; 3-hydroxy-1-methyl-5,6-indolinedione or adrenochrome; 4-tert-butyl-5-methoxy-1,2-benzoquinone; quinone pyrroloquinoline; or a salt or solvate thereof.
[000260] The sulfur-containing compound can be any suitable compound comprising one or more (for example, several) sulfur atoms. In one aspect, the sulfur-containing compound comprises a selected fraction of thionyl, thioether, sulfmyl, sulfonyl, sulfamide, sulfonamide, sulfonic acid, and sulfonic ester. Non-limiting examples of sulfur-containing compounds include ethanethiol; 2-propanethiol; 2-propene-1-thiol; 2-mercaptoethanesulfonic acid; benzenethiol; benzene-1,2-dithiol; cysteine; methionine; glutathione; cystine; or a salt or solvate thereof.
[000261] In one aspect, an efficient amount of a compound like this described above for cellulosic material as a molar ratio in cellulose glucosyl units is about 10'6 to about 10, for example, about 10'6 at about 7.5, about 10'6 to about 5, about 10'6 to about 2.5, about 10'6 to about 1, about 10 ' at about 1, about 10 '' to about 10'1, about 10'4 to about 10'1, about 10'J to about 10'1, or about 10 'to about 10 '-. In another aspect, an efficient amount of a compound like the one described above is about 0.1 μM to about IM, for example, about 0.5 μM to about 0.75 M, about 0.75 μM at about 0.5 M, about 1 μM to about 0.25 M, about 1 μM to about 0.1 M, about 5 μM to about 50 mM, about 10 μM to about 25 mM, about 50 μM to about 25 mM, about 10 μM to about 10 mM, about 5 μM to about 5 mM, or about 0.1 mM to about I mM.
[000262] The term "liquor" means the phase of the solution, both aqueous, organic, and a combination thereof, which arises from the treatment of a material with lignocellulose and / or hemicellulose in a slurry, or monosaccharides of the same, for example, xylose, arabinose, mannose, etc., in conditions as described herein, and the soluble contents thereof. A liquor for cellulolytic improvement of a GH6l polypeptide can be produced by treating a material with lignocellulose or hemicellulose (or raw material), applying heat and / or pressure, optionally in the presence of a catalyst, for example, acid, optionally in the presence of a solvent organic, and optionally in combination with physical interruption of the material, and then separating the solution from the residual solids. Such conditions determine the degree of cellulolytic improvement, obtained by combining liquor and a GH61 polypeptide, during the hydrolysis of a cellulosic substrate by a cellulase preparation. The liquor can be separated from the treated material using a standard method in the art, such as filtration, sedimentation or centrifugation.
[000263] In one aspect, an efficient amount of the cellulose liquor is about 10'6 to about 10 g per g of cellulose, for example, about 10'6 to about 7.5 g, about 10 ' 6 to about 5 g, about 10'6 to about 2.5 g, about 10'6 to about 1 g, about 10'5 to about 1 g, about 10'5 to about 10 ' 1 g, about 10'4 to about 10'1 g, about 10'J to about 10'1 g, or about 10 'to about 10' “g per g of cellulose.
[000264] Fermentation. Fermentable sugars obtained from hydrolyzed cellulosic material can be fermented by one or more (for example, several) fermenting microorganisms capable of fermenting sugars directly or indirectly in a desired fermentation product. "Fermentation" or "fermentation process" refers to any fermentation process or any process that comprises a fermentation step. Fermentation processes also include fermentation processes used in the alcohol consumption industry (for example, beer and wine), the bakery industry (for example, fermented bakery products), the leather industry and the tobacco industry. The fermentation conditions depend on the desired fermentation product and the fermenting organism, and can be easily determined by those skilled in the art.
[000265] In the fermentation step, the sugars, released from the cellulosic material as a result of the pre-treatment and enzymatic hydrolysis steps, are fermented in a product, for example, ethanol, by a fermenting organism, such as yeast. Hydrolysis (saccharification) and fermentation can be separated or simultaneous, as described here.
[000266] Any suitable hydrolyzed cellulosic material can be used in the fermentation step in the practice of the present invention. The material is generally selected on the basis of the desired fermentation product, that is, the substance to be obtained from the fermentation, and in the process employed, in a manner well known in the art.
[000267] It is understood here that the term "fermentation medium" refers to a medium before the fermenting microorganism (s) is (are) added, such as a medium that results from a saccharification process, as well as a medium used in a simultaneous saccharification and fermentation process (SSF).
[000268] "Fermenting microorganism" refers to any microorganism, including bacterial and fungal organisms, suitable for use in a desired fermentation process to produce a fermentation product. The fermenting organism can be hexose and / or pentose fermenting organisms, or a combination thereof. Both hexose and pentose fermenting organisms are well known in the art. Suitable fermenting microorganisms are capable of fermenting, that is, converting sugars, such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose and / or oligosaccharides, directly or indirectly into the desired fermentation product.
[000269] Examples of bacterial and fungal fermenting organisms that produce ethanol are described by Lin et al., 2006, Appl. Microbiol. Biotechnol. 69: 627-642.
[000270] Examples of fermenting microorganisms that can ferment hexose sugars include bacterial and fungal organisms, such as yeast. Preferred yeasts include strains of Candida, Kluyveromyces and Saccharomyces, for example, Candida sonorensis, Kluyveromyces marxianus and Saccharomyces cerevisiae.
[000271] Examples of fermenting organisms that can ferment pentose sugars in their natural state include bacterial and fungal organisms, such as some yeasts. Preferred xylose fermenting yeasts include strains of Candida, preferably C. sheatae or C. sonorensis; and Pichia strains, preferably P. stipitis, such as P. stipitis CBS 5773. Preferred pentose fermenting yeasts include Pachysolen strains, preferably P. tannophilus. Organisms that are not able to ferment pentose sugars, such as xylose and arabinose, can be genetically modified to accomplish this by methods known in the art.
[000272] Examples of bacteria that can efficiently ferment hexose and pentose in ethanol include, for example, Bacillus coagulans, Clostridium acetobutilicum, Clostridium thermocellum, Clostridium phytofermentans, Geobacillus sp., Thermoanaerobacter saccharolyticum and Zymomonas mobilis, Philippid.
[000273] Other fermenting organisms include strains of Bacillus, such as Bacillus coagulans', Candida, such as C. sonorensis, C. methanosorbosa, C. diddensiae, C. parapsilosis, C. naedodendra, C. blankii, C. entomophilia, C brassicae, C. pseudotropicalis, C. boidinii, C. utilis and C scehatae; Clostridium, such as C. acetobutilicum, C. thermocellum and C. phytofermentans', E. coli, especially E. coli strains that have been genetically modified to improve ethanol yield; Geobacillus sp .; Hansenula, such as anomalous Hansenula ', Klebsiella, such as K. oxytoca; Kluyveromyces, such as K. marxianus, K. lactis, K. thermotolerans and K. fragilis; Schizosaccharomyces, such as S. pombe ', Thermoanaerobacter, such as Thermoanaerobacter saccharolyticum and Zymomonas, such as Zymomonas mobilis.
[000274] In a preferred aspect, yeast is a Bretannomyces. In a more preferred aspect, the yeast is Bretannomyces clausenii. In another preferred aspect, the yeast is a Candida. In another more preferred aspect, the yeast is Candida sonorensis. In another more preferred aspect, the yeast is Candida boidinii. In another more preferred aspect, the yeast is Candida blankii. In another more preferred aspect, the yeast is Candida brassicae. In another more preferred aspect, the yeast is Candida diddensii. In another more preferred aspect, the yeast is Candida entomophiliia. In another more preferred aspect, the yeast is Candida pseudotropicalis. In another more preferred aspect, the yeast is Candida scehatae. In another more preferred aspect, the yeast is Candida utilis. In another preferred aspect, the yeast is a Clavispora. In another more preferred aspect, the yeast is Clavispora lusitaniae. In another more preferred aspect, the yeast is Clavispora opuntiae. In another preferred aspect, the yeast is a Kluyveromyces. In another more preferred aspect, the yeast is Kluyveromyces fragilis. In another more preferred aspect, the yeast is Kluyveromyces marxianus. In another more preferred aspect, the yeast is Kluyveromyces thermotolerans. In another preferred aspect, the yeast is a Pachysolen. In another more preferred aspect, the yeast is Pachysolen tannophilus. In another preferred aspect, the yeast is a Pichia. In another more preferred aspect, the yeast is a Pichia stipitis. In another preferred aspect, the yeast is Saccharomyces spp. In another more preferred aspect, the yeast is Saccharomyces cerevisiae. In another more preferred aspect, the yeast is Saccharomyces distaticus. In another more preferred aspect, the yeast is Saccharomyces uvarum.
[000275] In a preferred aspect, the bacterium is a Bacillus. In a more preferred aspect, the bacterium is Bacillus coagulans. In another preferred aspect, the bacterium is a Clostridium. In another more preferred aspect, the bacterium is Clostridium acetobutilicum. In another more preferred aspect, the bacterium is Clostridium phytofermentans. In another more preferred aspect, the bacterium is Clostridium thermocellum. In another more preferred aspect, the bacterium is Geobacilus sp. In another more preferred aspect, the bacterium is a Thermoanaerobacter. In another more preferred aspect, the bacterium is Thermoanaerobacter saccharolyticum. In another preferred aspect, the bacterium is a Zymomonas. In another more preferred aspect, the bacterium is Zymomonas mobilis.
[000276] Yeasts commercially available and suitable for ethanol production include, for example, BIOFERM ™ AFT and XR (NABC - North American Bioproducts Corporation, GA, United States), yeast ETANOL RED ™ (Fermentis / Lesaffre, United States) , FALI ™ (Fleischmann's Yeast, United States), FERMIOL ™ (DSM Specialties), GERT STRAND ™ (Gert Strand AB, Sweden), and SUPERSTART ™ and THERMOSACC ™ fresh yeast (Ethanol Technology, WI, United States).
[000277] In a preferred aspect, the fermenting microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as microorganisms that use xylose, which use arabinose, and which co-use xylose and arabinose.
[000278] The cloning of heterologous genes in various fermenting microorganisms led to the construction of organisms capable of converting hexoses and pentoses into ethanol (co-fermentation) (Chen and Ho, 1993, Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae, Appl. Biochem. Biotechnol. 39-40: 135-147; Ho et al., 1998, Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose, Appl. Environ. Microbiol. 64: 1852-1859; Kotter and Ciriacy , 1993, Xylose fermentation by Saccharomyces cerevisiae, Appl. Microbiol. Biotechnol. 38: 776-783; Walfridsson et al., 1995, Xylose- metabolizing Saccharomyces cerevisiae strains overexpressing the TKL1 and TALI genes encoding the pentose phosphate pathway enzymes transketolase and transketolase and Appl. Environ. Microbiol. 61: 4184-4190; Kuyper et al., 2004, Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: a proof of princip le, FEMS Yeast Research 4: 655-664; Beall et al., 1991, Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli, Biotech. Bioeng. 38: 296-303; Ingram et al., 1998, Metabolic engineering of bacteria for ethanol production, Biotechnol. Bioeng. 58: 204-214; Zhang et al., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis, Science 267: 240-243; Deanda et al., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl. Environ. Microbiol. 62: 4465-4470; WO 2003/062430, xylose isomerase).
[000279] In a preferred aspect, the genetically modified fermenting microorganism is Candida sonorensis. In another preferred aspect, the genetically modified fermenting microorganism is Escherichia coli. In another preferred aspect, the genetically modified fermenting microorganism is Klebsiella oxytoca. In another preferred aspect, the genetically modified fermenting microorganism is Kluyveromyces marxianus. In another preferred aspect, the genetically modified fermenting microorganism is Saccharomyces cerevisiae. In another preferred aspect, the genetically modified fermenting microorganism is Zymomonas mobilis.
[000280] It is well known in the art that the organisms described above can also be used to produce other substances, in the manner described herein.
[000281] The fermenting microorganism is typically added to the degraded or hydrolyzed cellulosic material, and fermentation is carried out for about 8 to about 96 hours, for example, about 24 to about 60 hours. The temperature is typically between about 26 ° C to about 60 ° C, for example, about 32 ° C or 50 ° C, and about pH 3 to about pH 8, for example, pH 4-5, 6 , or 7.
[000282] In one aspect, yeast and / or another microorganism are applied to the degraded cellulosic material, and fermentation is carried out for about 12 to about 96 hours, such as typically 24-60 hours. In another aspect, the temperature is preferably between about 20 ° C to about 60 ° C, for example, about 25 ° C to about 50 ° C, about 32 ° C to about 50 ° C, or about 32 ° C to about 50 ° C, and the pH is generally about pH 3 to about pH 7, for example, about pH 4 to about pH 7. However, some fermenting organisms, for example, bacteria, have a higher ideal fermentation temperature. Yeast or another microorganism is preferably applied in amounts of approximately 10 to 10 ″, preferably in approximately 107 to 1010, essentially approximately 2 x 10 viable cell counts per ml of fermentation broth. Additional guidance regarding the use of yeast for fermentation can be found in, for example, “The Alcohol Textbook” (Editors K. Jacques, TP Lyons and DR Kelsall, Nottingham University Press, UK 1999), which is incorporated by reference.
[000283] A fermentation stimulator can be used in combination with any of the processes described herein to further improve the fermentation process and, in particular, the performance of the fermenting microorganism, such as improving the ethanol rate and yield. A "fermentation stimulator" refers to stimulators for the growth of fermenting microorganisms, in particular, yeasts. Preferable fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavin and vitamins A, B, C, D, and E. See, for example, Alfenore et al., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is incorporated by reference. Examples of minerals include minerals and mineral salts that can supply nutrients that comprise P, K, Mg, S, Ca, Fe, Zn, Mn and Cu.
[000284] Fermentation products: A fermentation product can be any substance derived from fermentation. The fermentation product can be, without limitation, an alcohol (for example, arabinitol, n-butanol, isobutanol, ethanol, glycerol, methanol, ethylene glycol, 1,3-propanediol [ropylene glycol], butanediol, glycerin, sorbitol and xylitol ); an alkane (for example, pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane), a cycloalkane (for example, cyclopentane, cyclohexane, cycloheptane and cyclooctane), an alkene (for example pentene, hexene, heptene and octene); an amino acid (for example, aspartic acid, glutamic acid, glycine, lysine, serine and threonine); a gas (for example, methane, hydrogen (H2), carbon dioxide (CO2) and carbon monoxide (CO)); isoprene; a ketone (for example, acetone); an organic acid (for example, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diceto-D-gluconic acid, formic acid, fumaric acid, gluconic acid, gluconic acid, glucuronic acid, glutaric acid , 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid and xylonic acid) and polyketide. The fermentation product can also be protein as a high-value product.
[000285] In a preferred aspect, the fermentation product is an alcohol. It will be well understood that the term "alcohol" includes a substance that contains one or more (for example, several) hydroxyl fractions. In a more preferred aspect, the alcohol is n-butanol. In another more preferred aspect, the alcohol is isobutanol. In another more preferred aspect, the alcohol is ethanol. In another more preferred aspect, the alcohol is methanol. In another more preferred aspect, the alcohol is arabinitol. In another more preferred aspect, the alcohol is butanediol. In another more preferred aspect, the alcohol is ethylene glycol. In another more preferred aspect, the alcohol is glycerin. In another more preferred aspect, the alcohol is glycerol. In another more preferred aspect, the alcohol is 1,3-propanediol. In another more preferred aspect, the alcohol is sorbitol. In another more preferred aspect, the alcohol is xylitol. See, for example, Gong, CS, Cao, NJ, Du, J., and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, ed., Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Silveira, M. M., and Jonas, R., 2002, The biotechnological production of sorbitol, Appl. Microbiol. Biotechnol. 59: 400408; Nigam, P., and Singh, D., 1995, Processs for fermentative production of xylitol - a sugar substitute, Process Biochemistry 30 (2): 117-124; Ezeji, T. C., Qureshi, N. and Blaschek, H. P., 2003, Production of acetone, butanol and ethanol by Clostridium beijerinckii BAI01 and in situ recovery by gas stripping, World Journal of Microbiology and Biotechnology 19 (6): 595-603.
[000286] In another preferred aspect, the fermentation product is an alkane. The alkane can be an unbranched or branched alkane. In another more preferred aspect, the alkane is pentane. In another more preferred aspect, the alkane is hexane. In another more preferred aspect, the alkane is heptane. In another more preferred aspect, the alkane is octane. In another more preferred aspect, the alkane is nonane. In another more preferred aspect, the alkane is dean. In another more preferred aspect, the alkane is undecane. In another more preferred aspect, the alkane is dodecane.
[000287] In another preferred aspect, the fermentation product is a cycloalkane. In another more preferred aspect, cycloalkane is cyclopentane. In another more preferred aspect, cycloalkane is cyclohexane. In another more preferred aspect, the cycloalkane is cycloeptane. In another more preferred aspect, cycloalkane is cycloctane.
[000288] In another preferred aspect, the fermentation product is an alkene. The alkene can be an unbranched or branched alkene. In another more preferred aspect, the alkene is pentene. In another more preferred aspect, the alkene is hexene. In another more preferred aspect, the alkene is heptene. In another more preferred aspect, the alkene is octene.
[000289] In another preferred aspect, the fermentation product is an amino acid. In another more preferred aspect, the organic acid is aspartic acid. In another more preferred aspect, the amino acid is glutamic acid. In another more preferred aspect, the amino acid is glycine. In another more preferred aspect, the amino acid is lysine. In another more preferred aspect, the amino acid is serine. In another more preferred aspect, the amino acid is threonine. See, for example, Richard, A., and Margaritis, A., 2004, Empirical modeling of batch fermentation kinetics for poly (glutamic acid) production and other microbial biopolymers, Biotechnology and Bioengineering 87 (4): 501-515.
[000290] In another preferred aspect, the fermentation product is a gas. In another more preferred aspect, the gas is methane. In another more preferred aspect, the gas is H2. In another more preferred aspect, the gas is CO2. In another more preferred aspect, the gas is CO. See, for example, Kataoka, N., A. Miya, and K. Kiriyama, 1997, Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology 36 (6-7): 41-47 ; and Gunaseelan V.N. in Biomass and Bioenergy, Vol. 13 (1-2), pp. 83-114, 1997: Anaerobic digestion of biomass for methane production A review.
[000291] In another preferred aspect, the fermentation product is isoprene.
[000292] In another preferred aspect, the fermentation product is a ketone. It will be well understood that the term "ketone" includes a substance that contains one or more fractions (for example, several) of ketone. In another more preferred aspect, the ketone is acetone. See, for example, Qureshi and Blaschek, 2003, supra.
[000293] In another preferred aspect, the fermentation product is an organic acid. In another more preferred aspect, the organic acid is acetic acid. In another more preferred aspect, the organic acid is acetonic acid. In another more preferred aspect, the organic acid is adipic acid. In another more preferred aspect, the organic acid is ascorbic acid. In another more preferred aspect, the organic acid is citric acid. In another more preferred aspect, the organic acid is 2,5-diceto-D-gluconic acid. In another more preferred aspect, the organic acid is formic acid. In another more preferred aspect, the organic acid is fumaric acid. In another more preferred aspect, the organic acid is glucaric acid. In another more preferred aspect, the organic acid is gluconic acid. In another more preferred aspect, the organic acid is glucuronic acid. In another more preferred aspect, the organic acid is glutaric acid. In another preferred aspect, the organic acid is 3-hydroxypropionic acid. In another more preferred aspect, the organic acid is itaconic acid. In another more preferred aspect, the organic acid is lactic acid. In another more preferred aspect, the organic acid is malic acid. In another more preferred aspect, organic acid is malonic acid. In another more preferred aspect, the organic acid is oxalic acid. In another more preferred aspect, the organic acid is propionic acid. In another more preferred aspect, the organic acid is succinic acid. In another more preferred aspect, the organic acid is xylonic acid. See, for example, Chen, R., and Lee, Y. Y., 1997, Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass, Appl. Biochem. Biotechnol. 63-65: 435-448.
[000294] In another preferred aspect, the fermentation product is polyketide.
[000295] Recovery. The fermentation product (s) can optionally be recovered from the fermentation medium using any method known in the art including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation or extraction. For example, the alcohol is separated from the fermented cellulosic material and purified by conventional distillation methods. Ethanol with a purity of up to about 96 vol. % can be obtained, which can be used, for example, as ethanol fuel, ethanol for drinks, that is, neutral potable spirits or industrial ethanol.
[000296] The present invention is further described by the following examples, which should not be construed as limiting the scope of the invention. Examples Strains
[000297] The Trichoderma reesei strain 981-0-8 (D4) is a mutagenized strain of Trichoderma reesei RutC30 (ATCC 56765; Montenecourt and Eveleigh, 1979, Adv. Chem. Ser. 181: 289-301).
[000298] The Trichoderma reesei strain AgJgl 15-104-7B1 (PCT / US2010 / 061105, WO 2011/075677) is a ku70 derivative of the 981-0-8 strain of T. reesei (D4). Means and buffer solutions
[000299] 2XYT ampicillin plates plus were composed of 16 g tryptone, 10 g yeast extract, 5 g sodium chloride, 15 g Bacto agar, and 1 liter deionized water. One ml of a 100 mg / ml ampicillin solution was added after the autoclaved medium was cooled to 55 ° C.
[000300] SOC medium was composed of 20 g of Bacto-tryptone, 5 g of Bacto yeast extract, 0.5 g of NaCl, 2.5 ml of 1 M KCl, and 1 liter deionized water. The pH was adjusted to 7.0 with 10 N NaOH before autoclaving. Then 20 mL of sterile 1 M glucose was added immediately before use.
[000301] COVE salt solution was composed of 26 g of KC1, 26 g of MgSO4-7H2O, 76 g of KH2PO4, 50 ml of COVE metal trace solution, and 1 liter deionized water.
[000302] The COVE metal trace solution was composed of 0.04 g of NaB4O710H2O, 0.4 g of CuSO4-5H2O, 1.2 g of FeSO4-7H2O, 0.7 g of MnSO4H2O, 0.8 g of Na2MoO2-2H2O, 10 g of ZnSO4-7H2O, and 1 liter deionized water.
[000303] COVE plates were composed of 342.3 g of sucrose, 20 mL of COVE salt solution, 10 mL of 1 M acetamide, 10 mL of 1.5 M CsCl, 25 g of Noble agar (Difco), and water deionized to 1 liter.
[000304] COVE2 plates were composed of 30 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 25 g of Noble agar (Difco), and 1 liter deionized water.
[000305] Trichoderma metal trace solution was composed of 216 g FeCl3-6H2O, 58 g ZnSO4-7H2O, 27 g MnSO4H2O, 10 g CuSO4-5H2O, 2.4 g H3BO3, 336 g acid citrus, and deionized water at 1 liter.
[000306] CIM medium was composed of 20 g of cellulose, 10 g of corn maceration water solids, 1.45 g of (NH4) 2SO4, 2.08 g of KH2PO4, 0.28 g of CaCl2, 0, 42 g of MgSO4-7H2O, 0.42 mL of Trichoderma metal trace solution, 1-2 drops of antifoam, and 1 liter deionized water; pH adjusted to 6.0.
[000307] YP medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, and deionized water to 1 liter.
[000308] PEG buffer was composed of 500 g of polyethylene glycol 4000 (PEG 4000), mM CaCLIO, 10 mM Tris-HCl pH 7.5, and 1 liter deionized water; sterile filter.
[000309] PDA plates were composed of 39 g of Potato Dextrose Agar (Difco) and deionized water at 1 liter.
[000310] Excess PDA medium was composed of 39 g of Potato Dextrose Agar (Difco), 2.44 g of uridine, and 1 liter deionized water. The medium previously autoclaved was fined in a microwave oven and then tempered at 55 ° C before use.
[000311] STC was composed of 1 M sorbitol, 10 mM CaCl2, and 10 mM Tris-HCl, pH 7.5; sterile filter.
[000312] TE buffer was composed of 1 M Tris pH 8.0 and 0.5 M EDTA pH 8.0.
[000313] 20X SSC was composed of 175.3 g of NaCl, 88.2 g of sodium citrate, and deionized water at 1 liter.
[000314] TrMM-G medium was composed of 20 ml of COVE salt solution, 6 g of (NH4) 2SO4, 0.6 g of CaCl2, 25 g of noble agar (Difco), 20 g of glucose, and water deionized to 1 liter.
[000315] NZY + medium was composed of 5 g of NaCl, 3 g of MgSO4 7H2O, 5 g of yeast extract, 10 g of NZ amine, 1.2 g of MgCL, 4 g of glucose, and deionized water at 1 liter. Example 1: Construction of a Trichoderma reesei cbhl-Aspergillus fumigatus cbhl replacement construct pJfyS139
[000316] Aspergillus fumigatus cellobiohydrolase I (cbhT) encoding the sequence (SEQ ID NO: 1 [DNA sequence] and SEQ ID NO: 2 [deduced amino acid sequence]) was amplified from pEJG93 (WO 2011 / 057140) using the gene specific forward and reverse primers shown below. The italicized region represents vector homology with the insertion site for an IN-FUSION® reaction and the underlined portion is an introduced Pac I site.
[000317] Direct initiator: 5 '-cgcggactgcgcaccÁTGCTGGCCTCC ACCTTCTCCTACC-3 ’(SEQ ID NO: 31)
[000318] Reverse initiator: S’-ctttcgccacggagcttaattttCTACAGGCACTGAGAGTAATAATCA-S '(SEQ ID NO: 32)
[000319] The amplification reaction was composed of 20 ng of pEJG93, 200 μM dNTP's, 0.4 μM primers, IX HERCULASE® reaction buffer (Stratagene, La Jolla, CA, USA), and 1,875 units of high polymerase DNA fidelity HERCULASE® Hot Start (Stratagene, La Jolla, CA, USA) in a final volume of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S (Eppendorf Scientific, Inc., Westbury, NY, USA), programmed for 1 cycle at 95 ° C for 2 minutes; 30 cycles each at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute; and 1 cycle at 72 ° C for 7 minutes. The PCR products were separated by electrophoresis on 1% agarose gel using 40 mM Tris base, 20 mM sodium acetate, 1 mM disodium EDTA buffer, where a 1.6kb fragment was excised from the gel and extracted using a MINELUTE® gel extraction (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's protocol.
[000320] The 1.6 kb PCR product was inserted into pSMail55 digested with Neo I / Pαc I (WO 05/074647) using an INFUSION® Advantage PCR cloning kit (Clontech, Palo Alto, CA, USA) accordingly with the manufacturer's protocol. The IN-FUSION® reaction was composed of IX IN-FUSION® reaction buffer (Clontech, Palo Alto, CA, USA), 125 ng of pSMail55 digested with Neo I / Pαc I, 100 ng of 1.6 PCR product kb, and 1 μL of IN-FUSION® enzyme (Clontech, Palo Alto, CA, USA) in a reaction volume of 10 μL. The reaction was incubated for 15 minutes at 37 ° C followed by 15 minutes at 50 ° C. After the incubation period, 40 μL of TE buffer were added to the reaction. A 2 μL aliquot was used to transform competent ONE SHOT® TOP 10 cells (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The cells were exposed to thermal shock at 42 ° C for 30 seconds and 250 μL of SOC medium were added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 150 mm diameter plates with 2XYT and ampicillin and incubated at 37 ° C overnight. The resulting transformants were selected by sequencing and a clone containing the insert without any error-prone PCR was identified and pJfyS139-A determined. Plasmid pJfyS139-A was used for the insertion of the Herpes simplex virus thymidine kinase (tk) gene.
[000321] The Herpes simplex virus tk encoding the sequence (SEQ ID NO: 33 [DNA sequence] and SEQ ID NO: 34 [deduced amino acid sequence]) was released from pJfyS 1579-8-6 (WO 2010 / 039840) by digesting the plasmid with Bgl II and Bam Hl. Digestion was submitted to electrophoresis on 1% agarose gel using TAE buffer, where a 2.3 kb band was excised from the gel and extracted using a MINELUTE® gel extraction kit. The tk gene cassette was inserted into pJfyS 139-A treated with bovine intestinal phosphatase, digested with Bam Hl using a QUICK LIGATION ™ kit (New England Biolabs, Inc., Ipswich, MA USA) according to the manufacturer's protocol. The ligation reaction was composed of 50 ng of pJfyS139-A treated with Bam HI-digested bovine intestinal phosphatase, 50 ng of 2.3 kb tk gene insertion, QUICK LIGATION ™ IX buffer (New England Biolabs, Inc., Ipswich , MA USA), and 5 QUICK LIGASE ™ units (New England Biolabs, Inc., Ipswich, MA USA) in a final volume of 20 μL. The reaction was incubated at room temperature for 5 minutes and 2 μL of the reaction was used to transform competent ONE SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were exposed to thermal shock at 42 ° C for 30 seconds and 250 μL of SOC medium were added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 150 mm diameter plates with 2XYT and ampicillin and incubated at 37 ° C overnight. The resulting transformants were selected by Xma I restricted digestion analysis to determine the presence and orientation of the insertion, and a clone containing the insertion was identified and determined pJfyS139-B. Plasmid pJfyS139-B was used for the insertion of a flanking sequence for the T. reesei 3 'cbhl gene.
[000322] The 3 'cbhl gene flanking sequence was amplified from T. reesei RutC30 genomic DNA using the forward and reverse primers below. The underlined portion represents a Not I site introduced for cloning. Direct launcher: 5 ’-ttagactgçggççgçGTGGCGAAAGCCTGACGC ACCGGTAGAT-3’ (SEQ ID NO: 35) Reverse launcher: 5 ’-agtagttagcggccgcACGGCACGGTTAAGCAGGGTCTTGC-3’ (SE)
[000323] Trichoderma reesei RutC30 was grown in 50 ml of YP medium supplemented with 2% glucose (w / v) in a 250 ml shaking flask at the bottom at 28 ° C for 2 days with shaking at 200 rpm. Mycelia were collected by filtration using MIRACLOTH® (Calbiochem, La Jolla, CA, USA), washed twice in deionized water, and frozen in liquid nitrogen. The frozen mycelia were ground by mortar and pestle into a fine powder. Total DNA was isolated using a DNEASY® Plant Maxi Kit (QIAGEN Inc., Valencia, CA, USA) with the lithic incubation extending over 2 hours.
[000324] The amplification reaction was composed of 150 ng of genomic DNA from T reesei RutC30, 200 μM dNTP's, 0.4 μM primers, IX HERCULASE® reaction buffer, and 1.875 units of HERCULASE® Hot Start polymerase HERCULASE® Hot Start in a final volume of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 95 ° C for 2 minutes; 30 cycles each at 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 1 minute 30 seconds; and 1 cycle at 72 ° C for 7 minutes.
[000325] The PCR reaction was submitted to a MINELUTE® nucleotide removal kit (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's protocol. The resulting PCR mixture was digested with Not I and the digested PCR products were separated by electrophoresis on 1% agarose gel using TAE buffer. A 1.3 kb fragment containing the 3 'cbhl gene flanking sequence was excised from the gel and extracted using a MINELUTE® gel extraction kit. The 1.3 kb fragment was inserted into pJfyS139-B treated with bovine intestinal phosphatase linearized with Not I, using a QUICK LIGATION ™ kit. The QUICK LIGATION ™ reaction was composed of 100 ng of pJfyS139-B treated with bovine intestinal phosphatase linearized with Not I, 20 ng of the 1.3 kb fragment, QUICK LIGATION ™ IX buffer, and 5 QUICK LIGASE ™ units in one final volume of 20 μL. The reaction was incubated at room temperature for 5 minutes and 2 μL of the reaction was used to transform competent ONE SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were exposed to thermal shock at 42 ° C for 30 seconds and 250 μL of SOC medium were added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 150 mm diameter plates with 2XYT and ampicillin and incubated at 37 ° C overnight. The resulting transformants were selected by Xma I restriction digestion analysis to determine the presence and orientation of the insertion, and the positive clones were sequenced. A clone containing the 3 'cbhl gene flanking sequence without any PCR error was determined pJfyS139 (Figure 1). Plasmid pJfyS139 was used as the vector to replace the T. reesei cbhl gene. Example 2: Generation and transformation of the Trichoderma reesei protoplast
[000326] Preparation and transformation of the protoplast were carried out using a protocol modified by Penttila et al., 1987, Gene 61: 155-164. Briefly, the strain of Trichoderma reesei AgJgl 15-104-7B1 (PCT / US2010 / 061105, WO 2011/075677) was cultured in 25 mL of YP medium supplemented with 2% (w / v) glucose and 10 mM uridine at 27 ° C for 17 hours with gentle agitation at 90 rpm. Mycelia were collected by filtration using a Disposable Vacuum Filtration System (Millipore, Bedford, MA, USA) and washed twice with deionized water and twice with 1.2 M sorbitol. Protoplasts were generated by suspending the washed mycelia in 20 mL of 1.2 M sorbitol containing 15 mg of GLUCANEX® 200 G (Novozymes A / S, Bagsvaerd, Denmark) per mL and 0.36 chitinase units (Sigma Chemical Co., St. Louis, MO, USA) per mL for 15 -25 minutes at 34 ° C with gentle stirring at 90 rpm. Protoplasts were collected by centrifuging for 7 minutes at 400 x g and washed twice with cold 1.2 M sorbitol. The protoplasts were counted using a hemocytometer and resuspended to a final concentration of 1x10 protoplasts / mL in CTS. Excess protoplasts were stored in a 1 ° C Cryo Freezing Container (Nalgene, Rochester, NY, USA) at -80 ° C.
[000327] Approximately 100 μg of a transforming plasmid described in the following examples was digested with Pme I. The digestion reaction was purified by electrophoresis on 1% agarose gel using TAE buffer. A DNA band was excised from the gel and extracted using a QIAQUICK® gel extraction kit (QIAGEN Inc., Valencia, CA, USA). The resulting purified DNA was added to 100 μL of the protoplast solution and mixed gently. PEG buffer (250 μL) was added, mixed and incubated at 34 ° C for 30 minutes. STC (3 mL) was then added, mixed and spread on PDA plates supplemented with 1M sucrose. After incubation at 28 ° C for 16 hours, 20 mL of an overlapping PDA medium and supplemented with 35 μg of hygromycin B per mL were added to each plate. The plates were incubated at 28 ° C for 4-7 days. Example 3: Replacement of the natural Trboderma reesei cbhl gene by Aspergillus fumigatus cbhl
[000328] In order to replace the natural Trichoderma reesei cbhl gene (SEQ ID NO: 17 [DNA sequence] and SEQ ID NO: 18 [deduced amino acid sequence]) with the Aspergillus fumigatus cbhl (SEQ ID NO: 1 [ DNA sequence] and SEQ ID NO: 2 [deduced amino acid sequence]), the strain Trichoderma reesei ku70- AgJgl 15-104-7B1 (PCT7US2010 / 061105, WO 2011/075677) was transformed with 4 x 2 μg of linearized pJfyS139 with Pme I (Example 1) according to the procedure described in example 2. Seven transformants were obtained and each was chosen and transferred to a PDA plate and incubated for 7 days at 28 ° C. Genomic DNA was isolated from the transformants according to the procedure described in example 1, and each transformant was subjected to Southern analysis.
[000329] For Southern analysis, 2 μg of genomic DNA were digested with 33 units of Bgl II in a reaction volume of 50 μL, and subjected to electrophoresis in 1% agarose in TAE buffer. The DNA in the gel was repurified with a 10 minute wash in 0.25 N HCl, denatured with 15 minute wash in 0.5 N NaOH 1.5 M, neutralized with a 30 minute wash in 1 M Tris pH 8-NaCl 1.5 M, and incubated in 20X SSC for 5 minutes. The DNA was transferred to a NYTRAN® Supercharge membrane (Whatman, Inc., Florham Park, NJ, USA) using a TURBOBLOTTER ™ system (Whatman, Inc., Florham Park, NJ, USA) according to the manufacturer's protocol. The DNA was crosslinked by UV on the membrane using a STRATALINKER ™ UV crosslinker (Stratagene, La Jolla, CA, USA) and prehybridized for 1 hour at 42 ° C in 20 mL of DIG Easy Hyb (Roche Diagnostics Corporation, Indianapolis, IN, USA).
[000330] A probe that hybridizes to the 3 'cbhl gene flanking sequence was generated using a PCR Dig probe synthesis kit (Roche Diagnostics Corporation, Indianapolis, IN, USA) according to the manufacturer's instructions, with the primers direct and reverse shown below. The PCR reaction was composed of IX HERCULASE® reaction buffer, 400 nM of each primer, dNTPs containing 200 µM DIG-labeled dUTP, 20 ng of pJfyS139, and 1.5 units of HERCULASE® Hot Start high-fidelity polymerase DNA. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 95 ° C for 2 minutes; 25 cycles each at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 40 seconds; and 1 cycle at 72 ° C for 7 minutes. Direct starter: 5’-AAAAAACAAACATCCCGTTCATAAC-3 ’(SEQ ID NO: 37) Reverse starter: 5’-AACAAGGTTTACCGGTTTCGAAAAG-3’ (SEQ ID NO: 38)
[000331] The probe was purified by electrophoresis on 1% agarose gel using TAE buffer, where a 0.5 kb band corresponding to the probe was excised from the gel and extracted using a MINELUTE® gel extraction kit. The probe was boiled for 5 minutes, cooled on ice for 2 minutes, and added to 10 mL of DIG Easy Hyb to produce the hybridization solution. Hybridization was carried out at 42 ° C for 15-17 hours. The membrane was then washed under conditions of low severity in SSC 2X and 0.1% SDS for 5 minutes at room temperature, followed by two washes in high severity in SSC 0.5X and 0.1% SDS for 15 minutes each at 65 ° C. Probe-tagged hybrids were detected by chemiluminescence assay (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Southern analysis indicated that 3 of the 7 transformants contained the cassette replacement at the cbhl locus, and one transformant, T. reesei JfyS 139-8, was chosen to cure the hpt and tk markers.
[000332] A new spore plate was generated by transferring spores from a 7 day PDA plate, grown at 28 ° C, to a PDA plate and incubating for 7 days at 28 ° C. Spores were collected in 10 mL of TWEEN® 20 at 0.01% using a sterile spreader. The spore concentration was determined using a hemocytometer and 105 spores were spread over 150 mm plates containing TrMM-G medium supplemented with 1 μM of 5-fluorine-2'-deoxyuridine (FdU).
[000333] Three hundred isolated spores resistant to FdU were obtained and the DNA was extracted from 2 of the isolated spores, as previously described. The isolates were subjected to Southern analysis in the manner described above, and the results indicated that both spore isolates were excised from the hpt / tk region between the homologous repetitions of the replacement cassette. A specific strain T. reesei JfyS139-8A was chosen to replace the cbhll gene. Example 4: Construction of an empty Trichoderma reesei cbhll replacement construct
[000334] To generate a construct to replace the Trichoderma reesei cbhll gene (SEQ ID NO: 19 [DNA sequence] and SEQ ID NO: 20 [deduced amino acid sequence]) with the Aspergillus fumigatus cbhll (SEQ ID NO: 3 [DNA sequence] and SEQ ID NO: 4 [deduced amino acid sequence]), the T reesei cbhll promoter was first amplified from the T. reesei RutC30 genomic DNA using the gene specific forward and reverse primers shown below . The italicized region represents vector homology with the insertion site in an IN-FUSION® reaction. The genomic DNA of T. reesei RutC30 was prepared according to the procedure described in example 1. Direct primer: 5 '-acgaattgtttaaacgtcgacCC AAGT ATCC AG AGGT GT AT GGAAATAT C AG AT - 3' (SEQ ID NO: 39) Reverse primer: 5 '-cgcgtagatctgcggccatGGIGC AATACACAGAGGGTGATCTT-3' (SEQ ID NO: 40)
[000335] The amplification reaction was composed of 20 ng of genomic DNA from T. reesei RutC30, 200 μM dNTP's, 0.4 μM primers, IX HERCULASE® reaction buffer, and 1,875 units of HERCULASE® Hot high-fidelity polymerase DNA Start at a final volume of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® programmed for 1 cycle at 95 ° C for 2 minutes; 25 cycles each at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute 30 seconds; and 1 cycle at 72 ° C for 7 minutes. The PCR products were separated by electrophoresis on 1% agarose gel using TAE buffer, where a 1.6kb fragment was excised from the gel and extracted using a MINELUTE® gel extraction kit.
[000336] The 1.6 kb PCR product was inserted into pSMail55 digested with Neo l / Sal I (WO 05/074647), using an INFUSION® Advantage PCR cloning kit according to the manufacturer's protocol. The IN-FUSION® reaction was composed of IX IN-FUSION® reaction buffer, 125 ng of pSMail55 digested with Neo I / Sal I, 100 ng of the 1.6 kb PCR product, and 1 μL of IN-FUSION enzyme ® in a reaction volume of 10 μL. The reaction was incubated for 15 minutes at 37 ° C and 15 minutes at 50 ° C. After the incubation period, 40 μL of TE were added to the reaction. A 2 μL aliquot was used to transform competent ONE SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were exposed to thermal shock at 42 ° C for 30 seconds and 250 μL of SOC medium were added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 150 mm diameter plates with 2XYT and ampicillin and incubated at 37 ° C overnight. The resulting transformants were selected by Pci I restriction digestion analysis and the positive clones were sequenced to ensure the absence of PCR errors. A clone containing the insert with no PCR error was identified and pJfyS142-A determined. Plasmid pJfyS142-A was used to insert the T reesei cbhll terminator.
[000337] The cbhll terminator was amplified from T. reesei RutC30 genomic DNA using the gene specific forward and reverse primers shown below. The italicized region represents vector homology with the insertion site in an IN-FUSION® reaction. Direct launcher: 5 ’-« ictocgcgtoctogrzuα / toβGGCTTTCGTGACCGGGCTTCAAACA-3 ’(SEQ ID NO: 41) Reverse launcher: 5’ -gcggccgttactagtggαrccACTCGG AGTTGTTAT AC'CTGTC
[000338] The amplification reaction was composed of 150 ng of T. reesei RutC30 genomic DNA, 200 μM dNTP's, 0.4 μM primers, IX HERCULASE® reaction buffer, and 1,875 units of HERCULASE® Hot Start high-fidelity polymerase DNA in a final volume of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® programmed for 1 cycle at 95 ° C for 2 minutes; 25 cycles each at 95 ° C for 30 seconds, 54 ° C for 30 seconds, and 72 ° C for 50 seconds; and 1 cycle at 72 ° C for 7 minutes. The PCR products were separated by electrophoresis on 1% agarose gel using TAE buffer, where a 0.3 kb fragment was excised from the gel and extracted using a MINELUTE® gel extraction kit.
[000339] The 0.3 kb PCR product was inserted into Pac I / Bam Hl-digested pJfyS142-A using an IN-FUSION® Advantage PCR Cloning Kit according to the manufacturer's protocol. The INFUSION® reaction was composed of Reaction buffer IX IN-FUSION®, 150 ng of the digested by Pacl / Bam Hl pJfyS142-A, 50 ng of the 0.3 kb PCR product, and 1 μL of IN-FUSION enzyme ® in a reaction volume of 10 μL. The reaction was incubated for 15 minutes at 37 ° C and 15 minutes at 50 ° C. After the incubation period, 40 μL of TE were added to the reaction. A 2 μL aliquot was used to transform competent One SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were heat shocked at 42 ° C for 30 seconds and 250 μL of SOC medium was added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 2XYT ampicillin plates over 150 mm in diameter and incubated at 37 ° C overnight. Transformants were classified by sequence analysis to identify positive clones and to ensure the absence of PCR errors. A clone containing the insert with no PCR error was identified and designated pJfyS 142-B. Plasmid pJfyS 142-B was used for insertion of the Herpes simplex tk gene.
[000340] The Herpes simplex tk gene was released from pJfyS 1579-8-6 (WO 2010/039840) by digesting the plasmid with Bgl II and Bam Hl. Digestion was subjected to 1% agarose gel electrophoresis using TAE buffer where a 2.3 kb band was excised from the gel and extracted using a MINELUTE® Gel Extraction Kit. The tk cassette was inserted into the phosphatase-dephosphorylated pJfyS 142-B of calf intestine digested by Bam Hl using a QUICK LIGATION ™ Kit according to the manufacturer's protocol. The ligation reaction was composed of 50 ng of the phosphatase-dephosphorylated pJfyS 142-B calf intestine digested by Bam Hl, 50 ng of the 2.3 kb tk gene insert, Buffer IX QUICK LIGATION ™, and 5 QUICK units LIGASE ™ in a bond volume of 20 μL. The reaction was incubated at room temperature for 5 minutes and 2 μL of the reaction was used to transform competent One SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were heat shocked at 42 ° C for 30 seconds and 250 μL of SOC medium was added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 2XYT ampicillin plates over 150 mm in diameter and incubated at 37 ° C overnight. The resulting transformants were classified by restriction digestion analysis with Xma I and Bam Hl to determine the presence and orientation of the insert and a clone containing the insert was identified and designated pJfyS142-C. Plasmid pJfyS142-C was used to insert the flanking sequence of the T. reesei 3 'cbhll gene.
[000341] The flanking sequence of the 3 'cbhll gene was amplified from T. reesei RutC30 genomic DNA using the forward and reverse primers shown below. The region in italics represents the homology of the vector with the insertion site for an IN-FUSION® reaction. Direct launcher: 5 ’- <2 / ccaící7Cí7cZggcggccgcGCTTCAAACAATGATGTGCGATGGT-3’ (SEQ ID NO: 43) Reverse launcher: 5 ’-gαZgcαZgc / cg <7gcggccgcCTACCTTGGAG
[000342] The amplification reaction was composed of 150 ng of T. reesei RutC30 genomic DNA, 200 μM dNTP's, 0.4 μM primers, IX HERCULASE® Reaction Buffer, and 1,875 hot-start high fidelity DNA Polymerase unit HERCULASE® in a final volume of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCICLOR® programmed for 1 cycle at 95 ° C for 2 minutes; 30 cycles each at 95 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 ° C for 1 minute at 50 seconds; and 1 cycle at 72 ° C for 7 minutes. The PCR reaction was subjected to 1% agarose gel electrophoresis using TAE buffer where a 1.5 kb band was excised from the gel and extracted using a MINELUTE® Gel Extraction Kit. The cbhll 3 'gene flanking sequence was inserted into pJfyS142-C using an IN-FUSION® Advantage PCR Cloning Kit according to the manufacturer's protocol. The IN-FUSION® reaction was composed of IN-FUSION® IX Reaction buffer, 150 ng of pJfyS142-C NOT / -linearized, 80 ng of the 1.5 kb PCR product, and 1 μL of IN-FUSION enzyme ® in a reaction volume of 10 μL. The reaction was incubated for 15 minutes at 37 ° C and 15 minutes at 50 ° C. After the incubation period, 40 μL of TE were added to the reaction. A 2 μL aliquot was used to transform competent One SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were heat shocked at 42 ° C for 30 seconds and 250 μL of SOC medium was added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 2XYT ampicillin plates over 150 mm in diameter and incubated at 37 ° C overnight. The resulting transformants were classified by restriction digestion analysis with Bgl II and positive clones were sequenced to ensure the absence of PCR errors. A clone containing the insert with no PCR error was identified and designated pJfyS 142 (figure 2). Plasmid pJfyS 142 was used for insertion of the A. fumigatus cbhll coding sequence. Example 5: Construction of a replacement construct for Trichoderma reesei cbhlI-Aspergillus fumigatus cbhll pJfyS 144
[000343] The Aspergillus fumigatus cbhll encoding the sequence (SEQ ID NO: 3 [DNA sequence] and SEQ ID NO: 4 [deduced amino acid sequence]) was amplified from pAlLo33 (WO 2011/057140), using the forward and reverse initiators shown below. The italicized region represents vector homology with the insertion site for an IN-FUSION® reaction. Direct launcher: 5’-c ^ gtgtoíígcaccATGAAGCACCTTGCATCTTCCATCG-3 ’(SEQ ID NO: 45) Reverse launcher: 5’-ccggtcαcgαααgccTTAATTAAAAGGACGGGTTAGCGTT-3’ (SEQ ID NO: 46)
[000344] The amplification reaction was made up of 20 ng pAlLo33, 200 μM dNTP's, 0.4 μM primers, HERCULASE® 1 mM Reaction Buffer, and 1,875 HERCULASE® hot-start High-fidelity Polymerase DNA unit in one volume end of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCICLOR® programmed for 1 cycle at 95 ° C for 2 minutes; 30 cycles each at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 2 minutes; and 1 cycle at 72 ° C for 7 minutes.
[000345] The PCR reaction was subjected to 1% agarose gel electrophoresis using TAE buffer where a 1.7 kb band was excised from the gel and extracted using a MINELUTE® Gel Extraction Kit. The 1.7 kb PCR product was inserted into pJfyS142 digested by Neo I / Pαc I (Example 4) using an IN-FUSION® Advantage PCR Cloning Kit according to the manufacturer's protocol. The IN-FUSION® reaction was composed of Reaction IX INFUSION® buffer, 120 ng of the digested by Nco I / Pac / pJfyS142, 70 ng of the 1.7 kb PCR product, and 1 μL of IN-FUSION® enzyme in a reaction volume of 10 μL. The reaction was incubated for 15 minutes at 37 ° C and 15 minutes at 50 ° C. After the incubation period, 40 μL of TE were added to the reaction. A 2 μL aliquot was used to transform competent One SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were heat shocked at 42 ° C for 30 seconds and 250 μL of SOC medium was added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 2XYT ampicillin plates over 150 mm in diameter and incubated at 37 ° C overnight. The resulting transformants were sequenced to ensure the absence of PCR errors and to determine the presence of the insert. A clone with no error sequence was identified and designated pJfyS144 (figure 3). The plasmid pJfyS144 was used to replace the natural cbhll gene with the cbhll that A. fumigatus. Example 6: Replacement of the natural Trichoderma reesei cbhll gene by the Aspergillus fumigatus cbhll that encodes the sequence
[000346] In order to replace the natural T. reesei cbhll gene (SEQ ID NO: 19 [DNA sequence] and SEQ ID NO: 20 [deduced amino acid sequence]) with the Aspergillus fumigatus cbhll encoding the sequence (SEQ ID NO: 3 [DNA sequence] and SEQ ID NO: 4 [deduced amino acid sequence]), JfyS139-8A from Trichoderma reesei (Example 3) was transformed according to the procedure described in example 2 with 2 μg of linearized pJfyS144 in Pme and gel purified (Example 5). Seven transformants were obtained and each was chosen and transferred to a PDA plate and incubated for 7 days at 28 ° C. A PCR method for fungal spore described below was used to select transformants that carry the gene replacement using the direct primer shown below, ringing in a region upstream of the 5 'cbhll gene flanking sequence near the integration region, and the reverse primer shown below, annealing to the A. fumigatus cbhll that encodes the sequence. Direct starter: 5’-AGCCACATGCCGCATATTGACAAAG-3 ’(SEQ ID NO: 47) Reverse starter: 5’-AGGGATTCAGTGTGCTACAGGCTGC-3’ (SEQ ID NO: 48)
[000347] A 1.8 kb PCR product can be generated only upon the occurrence of a precise gene substitution at the cbhll locus. If the cassette has integrated anywhere in the genome, no amplification would result.
[000348] A small amount of spores from each transformant was suspended in 25 μL of TE buffer and heated overhead in a microwave oven for 1 minute. Each spore suspension heated in the microwave was used as a template in the PCR reaction. The reaction was composed of 1 μL of the spore suspension heated in the microwave, 1 μL of a 10 mM dNTPs, 12.5 μL of 2X ADVANTAGE® GC-Melt LA Buffer (Clontech, Mountain View, CA, USA), 25 pmol of forward primer, 25 pmol of reverse primer, 1.25 units of ADVANTAGE® GC Genomic LA Polymerase Mix (Clontech, Mountain View, CA, USA), and 9.25 μL of water. The reaction was incubated in an S EPPENDORF® MASTERCICLOR® 5333 epgradient programmed for 1 cycle at 95 ° C for 10 minutes; 35 cycles each at 95 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 ° C for 1 minute 40 seconds; 1 cycle at 72 ° C for 7 minutes; and a soak at 4 ° C. PCR reactions were subjected to 1% agarose gel electrophoresis using TAE buffer. The PCR spore indicated that four of the seven transformants contained the replacement cassette in the targeted locus and three of them were submitted to Southern analysis to confirm that the replacement cassette was in a single copy.
[000349] Genomic DNA was isolated from the three transformants according to the procedure described in example 1 and each transformant subjected to Southern analysis. For Southern analysis, 2 μg of genomic DNA was digested with 50 units of Dra I in a reaction volume of 50 μL and subjected to 1% agarose electrophoresis using TAE buffer. The DNA in the gel was purified with a 10 minute wash in 0.25 N HCl, denatured with two 15 minute washings in 0.5 N NaOH 1.5 M, neutralized with a 30 minute wash in 1 M Tris pH 8-1.5 M NaCl, and incubated in 20X SSC for 5 minutes. The DNA was transferred to a NYTRAN® Supercharge membrane. The DNA was crosslinked by UV on the membrane using a STRATALINKER ™ UV crosslinker and prehybridized for 1 hour at 42 ° C in 20 mL of DIG Easy Hyb.
[000350] A probe that hybridizes to the flanking sequence of the cbhll 3 'gene was generated using a Dig Probe Synthesis PCR Kit according to the manufacturer's instructions with the forward and reverse primers indicated below. The PCR reaction was composed of Reaction IX HERCULASE® buffer, 400 nM each primer, 200 μM dNTPs containing DIG-labeled dUTP, 150 ng of T. reesei RutC30 genomic DNA, and 1.5 units of high polymerase DNA HERCULASE® hot start fidelity. The reaction was incubated in an S EPPENDORF® MASTERCICLOR® 5333 epgradient programmed for 1 cycle at 95 ° C for 2 minutes; 30 cycles each at 95 ° C for 30 seconds, 51 ° C for 30 seconds, and 72 ° C for 40 seconds; and 1 cycle at 72 ° C for 7 minutes. Direct starter: 5’-AAAAAACAAACATCCCGTTCATAAC-3 ’(SEQ ID NO: 49) Reverse starter: 5’-AACAAGGTTTACCGGTTTCGAAAAG-3’ (SEQ ID NO: 50)
[000351] The probe was purified by 1% agarose gel electrophoresis using TAE buffer where a 0.5 kb band corresponding to the probe was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The probe was boiled for 5 minutes, cooled on ice for 2 minutes, and added to 10 mL of DIG Easy Hyb to produce the hybridization solution. Hybridization was carried out at 42 ° C for approximately 17 hours. The membrane was then washed under low severity conditions in SDS 2X SSC plus 0.1% for 5 minutes at room temperature followed by two high severity washes in SDS 0.5X SSC plus 0.1% for 15 minutes each at 65 ° C. ° C. The target probe hybrids were detected by chemiluminescence assay (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Southern analysis indicated that the three transformants contained the replacement cassette at the cbhll locus and all three (designated JfyS 139 / 144-5, -6, and -10) were chosen to cure the hpt and tk markers.
[000352] A new spore plate for each transformant was generated by transferring a plug from a 7-day culture grown on a PDA plate at 28 ° C to a new PDA plate and incubating for 7 days at 28 ° C. The spores were collected in 10 mL of TWEEN® 20 0.01% using a sterile spreader. The spore concentration was determined using a hemacytometer and 10 and 104 spores were spread on the 150 mm plates containing TrMM-G medium supplemented with 1 μM FdU.
[000353] Approximately 500 spore isolates resistant to FdU for each transformant were obtained from the plate containing 103 spores and approximately 100 spore isolates resistant to FdU for each transformant on the plate containing 104 spores. Eight spore isolates were selected for JfyS 139 / 144-5 and -6 strains and four were selected for JfyS 139 / 144-10 strain. Each isolate 1 to 8 of the 5 primary transformants was designated JfyS 139 / 144-5A at -5H. Isolates 1 to 8 of the 6 primary transformants were designated JfyS139 / 144-6A at 6H. Isolates from the 10 primary transformants were designated JfyS 139 / 144-10A at 10D for isolates 1 to 4. Spore PCR was conducted as described above, using the forward and reverse primers shown below, to confirm the hpt and tk markers were correctly excised. Direct starter: 5’-GTTAAGCATACAATTGAACGAGAATGG-3 ’(SEQ ID NO: 51) Reverse starter: 5’-GATGATATAATGGAGCAAATAAGGG-3’ (SEQ ID NO: 52)
[000354] The PCR reactions were performed as previously described with the following cycling parameters: 1 cycle at 95 ° C for 2 minutes; 30 cycles each at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 6 minutes seconds; and 1 cycle at 72 ° C for 7 minutes.
[000355] The ring primers in the 5 '(forward) and 3' (reverse) flanking sequence used for the replacement of the cbhll gene. Strains from which the hpt / tk cassette was correctly excised exhibited a 3.5 kb fragment, while those with the intact markers would exhibit an 8 kb fragment. The PCR classification indicated that all spore isolates correctly excised the hpt / tk cassette.
[000356] DNA was extracted from spore isolates A and B from each primary transformant and subjected to Southern analysis, as previously described. Southern analysis confirmed that each spore isolate correctly excised the hpt / tk cassette. Spore isolated from T. reesei JfyS 139 / 144-1OB was chosen to represent the strain containing both the T. reesei cbhl and cbhll genes replaced with the respective Aspergillus fumigatus counterparts. Example 7: Generation of plasmid pTH239 for repair of the ku70 gene of Trichoderma reesei
[000357] Four DNA segments were combined using an IN-FUSION® Advantage PCR Cloning Kit to generate a construct to replace the Trichoderma reesei ku70 coding sequence disrupted with the native Trichoderma reesei ku70 coding sequence (SEQ ID NO: 53 [DNA sequence] and SEQ ID NO: 54 [deduced amino acid sequence]). The ampicillin resistance marker region including the prokaryotic origin of replication was amplified from pJfyS 139-B (Example 4) using the sequence specific forward and reverse primers shown below (SEQ ID NOs: 55 and 56). The remaining T reesei ku70 gene sequence (consisting of 989 bp of the remaining ku70 coding sequence in the first 1,010 bp ku70 coding sequence) was amplified from T. reesei 981-0-8 genomic DNA using the forward and specific to the sequence shown below (SEQ ID NOs: 57 and 58). The T. reesei ku70 gene from the downstream sequence (consisting of a 500 bp segment repeated from the 3 'end of the 1010 bp ku70 coding sequence amplified in the upstream PCR product, and a 1,067 bp segment containing the remainder of the ku70 coding sequence, and 461 bp of the ku70 coding sequence downstream) was amplified from T. reesei 981-0-8 genomic DNA using the forward and reverse primers specific to the sequence shown below (SEQ ID NOs: 59 and 60). Genomic DNA from T. reesei 981-0-8 was prepared according to the procedure described in example 1. Direct primer: 5'- GTGTGCGGCCGCTCGAGCATGCATGTTTAAACAGCTTGGCACTGGC CGTCGTTTT-3 '(SEQ ID NO: 55) Reverse primer: 5'- ATCATGGGGGGGGGGA 3 '(SEQ ID NO: 56) Direct initiator: 5'- CATGATTACGAATTGTTTAAACGCGGCGCCGTCTCGGGGCTGATCT TGTCGAGGA-3' (SEQ ID NO: 57) Reverse initiator: 5'- GGCGGCCGTTACTAGTGGATCCAGCCCTGGAGAGGCTGG - TGCAGATATCCATCACACTGGCGGCCGCAGTTTCCATGTCCAACGT GTTGTTTTGCG C-3 '(SEQ ID NO: 59) Reverse initiator: 5'- GCCAGTGCCAAGCTGTTTAAACATGCATGCTCGAGCGGCCGCACQ CGCCCCGCGCGCCCGCCCGCGCCCGCCCCC
[000358] To amplify the ampicillin resistance marker and prokaryotic origin of the replication region, the reaction was composed of 100 ng of genomic DNA from T. reesei 981-0-8, 200 μM dNTPs, 1 μM from each primer (SEQ ID NO: 55 and 56), IX PHUSION® high fidelity DNA polymerase buffer (New England Biolabs, Inc., Ipswich, MA, USA), and 1.0 unit of PHUSION® High-Fidelity Hot Start DNA polymerase (New England Biolabs, Inc., Ipswich, MA, USA) in a final volume of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 98 ° C for 30 seconds; 30 cycles each at 98 ° C for 10 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute 30 seconds; and 1 cycle at 72 ° C for 7 minutes. The PCR product was separated by electrophoresis on 1% agarose gel using TAE buffer, where a 2.692 kb fragment was excised from the gels and extracted using a MINELUTE® gel extraction kit.
[000359] For amplification of the upstream or downstream sequence of the ku70 gene, the reactions were composed of 100 ng of pJfyS 139-B, 200 μM dNTPs, 1 μM of each primer (SEQ ID NOs: 57 and 58 or 59 and 60, respectively), PHUSION® High-Fidelity Hot Start DNA polymerase IX buffer, and 1.0 PHUSION® High-Fidelity Hot Start DNA polymerase buffer in a final volume of 50 μL. The amplification reactions were incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 98 ° C for 30 seconds; 30 cycles each at 98 ° C for 10 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute 30 seconds; and 1 cycle at 72 ° C for 7 minutes. The PCR products were separated by electrophoresis on 1% agarose gel using TAE buffer, where fragments of 1,999 kb and 2,028 were excised separately from the gels and extracted using a MINELUTE® gel extraction kit.
[000360] The fourth segment of DNA was generated from a restriction enzyme digestion of pJfyS139-B with NOT I and Bam HL The reaction was composed of 5 μg of pJfyS 139-B, 10 units of NOT I, 20 units of Bam Hl, and 20 μL of Restriction Enzyme Buffer 2 (New England Biolabs, Inc., Ipswich, MA, USA) in a total volume of 50 μL. The reaction was incubated for 1 hour at 37 ° C and then separated by 1% agarose gel electrophoresis using TAE buffer where a 4,400 kb fragment was excised from the gel and extracted using a MINELUTE® Gel Extraction Kit.
[000361] The three 2,028 bp, 1,999 bp, and 2,692 bp PCR products were inserted into the pJfyS139-B digested by NOT I and Bam HI using an IN-FUSION® Advantage PCR Cloning Kit according to the protocol of the manufacturer. The IN-FUSION® reaction was composed of Reaction IX IN-FUSION® buffer, 50 ng of the pJfyS139-B digested by NOT UBam HI, 50 ng of the PCR product upstream of the ku70 gene of 1,999 kb, 50 ng of the product of PCR downstream of the 2,028 kb ku70 gene, 50 ng of the 2,692 kb ampicillin resistance marker and prokaryotic origin of replication PCR product, and 1 μL of IN-FUSION® enzyme in a 10 μL reaction volume. The reaction was incubated for 15 minutes at 37 ° C followed by 15 minutes at 50 ° C. After the incubation period, 40 μL of TE were added to the reaction. A 3 μL aliquot was used to transform competent E. coli XL 10 GOLD® cells (Stratagene, La Jolla, CA, USA) according to the manufacturer's protocol. The cells were heat shocked at 42 ° C for 30 seconds and then 500 μL of NZY + medium, preheated to 42 ° C, was added. The tubes were incubated at 37 ° C with shaking at 200 rpm for 40 minutes and then plated on 2XYT ampicillin plates over 150 mm in diameter and incubated at 37 ° C overnight. The resulting transformants were classified by restriction digestion analysis with Hind III and Xba I and positive clones sequenced to ensure the absence of PCR errors. A clone containing the insert with no PCR error was identified and designated pTH239. Example 8: Repair of the ku70 gene in the JfyS139 / 144-10B replacement strain of A. fumigatus cbhl and cbh2
[000362] The native Trichoderma reesei ku70 gene was repaired in the T. reesei strain JfyS 139 / 144-10B (Example 6) in order to facilitate the manipulation steps in the strain by requiring the function of the ku70 gene at the junction of the non-homologous end . JfyS 129 / 144-10B from T. reesei was transformed with 23 x 2 μg of pTH239 Pme I-linearized (Example 7) according to the procedure described in example 2. Nineteen transformants were obtained and each of them was separately transferred to a PDA plate and incubated for 7 days at 28 ° C.
[000363] All nineteen transformants were classified by PCR to confirm homologous integration of the PTH239 Pme I fragment into the disrupted ku70 gene locus. For each of the transformants, a sterile inoculation loop was used to collect spores from a 7-day PDA plate. The spores were transferred to a tube containing 25 μL of 1 mM EDTA - 10 mM Tris buffer and heated in a high-power oven for 1 minute. A 1 μL aliquot of the spore mixture passed in the microwave was added directly to the PCR reaction as template DNA. A set of PCR primers shown below was designed to amplify across the disrupted region of the ku70 coding sequence to distinguish between the host genome with the disruption in the ku70 coding sequence (848 bp) and the targeted strain pTH239 of interest (606 bp). The PCR reaction was composed of LA Genomic IX Polymerase Reaction Buffer IX ADVANTAGE® (Clontech, Mountain View, CA, USA), 400 nM of each primer, 200 μM dNTPs, 1 μL of TE spore mixture passed in the microwave (previously described), and 1.0 units of VANTAGEM® Genomic LA Polymerase (Clontech, Mountain View, CA, USA). The amplification reaction was incubated in an EPPENDORF® MASTERCICLOR® 5333 epgradient programmed for 1 cycle at 95 ° C for 10 minutes; 30 cycles each at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 60 seconds; and 1 cycle at 72 ° C for 7 minutes. Direct starter: 5’-CAATGACGATCCGCACGCGT-3 ’(SEQ ID NO: 61) Reverse starter: 5’- CAATGACGATCCGCACGCGT-3’ (SEQ ID NO: 62)
[000364] Only one of the nineteen transformants (# 19) was positive for the 606 bp PCR product and negative for the 848 bp PCR product indicative of a strain containing the pTH239 Pmel fragment homologously integrated in the ku70 locus.
[000365] Spores from the 7-day PDA plate of transformant # 19 were collected in 10 mL of 0.01% TWEEN® 20 using a sterile spreader. The spore concentration was determined using a hemocytometer and 106 spores were spread on 150 mm plates containing TrMM-G medium supplemented with 1 μM 5-fluor-2'-deoxyuridine (FdU) and cultured for 5 days at 28 ° C. Twenty-two spore isolates resistant to FdU were obtained and transferred to PDA plates and cultured at 28 ° C for five days.
[000366] All twenty-two spore isolates (# 19A-V) were classified by PCR for excision of the hpt / tk marker region present between the homologous repetitions of the ku70 coding sequence in the repair cassette. For each of the spore isolates a sterile inoculation loop was used to collect spores from a 7-day PDA plate. The spores were transferred to a tube containing 25 μL of 1 mM EDTA-10 mM Tris buffer and passed over the microwave for 1 minute. A 1 μL aliquot of the spore mixture was added directly to the PCR reaction as template genomic DNA. A set of PCR primers shown below was designed to amplify across the hpt / tk region to distinguish between the presence (6 kb) or absence (1.1 kb) of the hpt / tk region. The PCR reaction was composed of LA Genomic IX VANTAGEM® Polymerase Reaction Buffer, 400 nM of each primer (below), 200 μM dNTPs, 1 μL of TE spore mixture passed in the microwave (described previously), and 1.0 unit of Polymerase LA Genomics VANTAGEM®. The amplification reaction was incubated in an EPPENDORF® MASTERCICLOR® 5333 epgradient programmed for 1 cycle at 95 ° C for 10 minutes; 30 cycles each at 95 ° C for 30 seconds, 50 ° C for 30 seconds, and 72 ° C for 6 minutes; and 1 cycle at 72 ° C for 7 minutes. Direct primer: 5’-GACACTCTTTTCTCCCATCT-3 ’(SEQ ID NO: 63) Reverse primer: 5’-GAGGAGCAGAAGAAGCTCCG-3’ (SEQ ID NO: 64)
[000367] All twenty-two spore isolates were negative for the 6 kb PCR product corresponding to the hpt / tk marker region.
[000368] Spores from the 7-day PDA plates of isolates # 19A and # 19L were collected in 10 mL of TWEEN® 20 0.01% using a sterile spreader. The spore concentration was determined using a 10, 10 “hemocytometer, and 10 spores were spread on 150 mm PDA plates containing 1 M sucrose and cultured for 3 days at 28 ° C. Ten spore isolates were selected from PDA plates for both # 19A and # 19L strains and transferred to fresh PDA plates and placed at 28 ° C.
[000369] Genomic DNA was extracted from 6 spore isolates of both # 19L and # 19A according to the procedure described in example 1 and subjected to Southern analysis.
[000370] For Southern analysis, 2 μg of genomic DNA were digested with (1) 5 units and 10 units, respectively, of Asc I and Xho I or (2) 5 units and 25 units, respectively, of Asc I and Apa I in a 50 μL of reaction volume and subjected to 1% agarose electrophoresis using TAE buffer. The DNA in the gel was purified with a 10 minute wash in 0.25 N HCl, denatured with two 15 minute washings in 0.5 N NaOH 1.5 M, neutralized with a 30 minute wash in 1 M Tris pH 8-1.5 M NaCl, and incubated in 20X SSC for 5 minutes. The DNA was transferred to a NYTRAN® Supercharge membrane using a TURBOBLOTTER ™ system according to the manufacturer's protocol. The DNA was crosslinked by UV on the membrane using a STRATALINKER ™ UV crosslinker and prehybridized for 1 hour at 42 ° C in 20 mL of DIG Easy Hyb.
[000371] A probe that hybridizes to the 3 'end of the ku70 encoding the sequence was generated using a probe synthesis kit for PCR Dig (Roche Diagnostics Corporation, Indianapolis, IN, USA) according to the manufacturer's instructions, with the forward and reverse primers shown below. In order to generate a pure template for the probe's PCR reaction, the 3 'end of the ku70 coding sequence was amplified from T. reesei 981-0-8 genomic DNA. The PCR reaction was composed of IX PHUSION® High Fidelity Hot Start DNA Polymerase Buffer, 1 μM of each primer, 200 μM dNTPs, 165 ng of T. reesei 981-0-8 genomic DNA, and 1.0 PHUSION® High Fidelity Hot Start DNA Polymerase unit. The amplification reaction was incubated in a S EPPENDORF® MASTERCICLOR® 5333 epgradient programmed for 1 cycle at 98 ° C for 30 seconds; 35 cycles each at 98 ° C for 10 seconds, 60 ° C for 30 seconds, and 72 ° C for 15 seconds; and 1 cycle at 72 ° C for 10 minutes. Direct starter: 5’-gcatatataacccactcaagta-3 ’(SEQ ID NO: 65) Reverse starter: 5’-attatcttggaccggccgcagg-3’ (SEQ ID NO: 66)
[000372] The 0.5 kb probe template was purified by 1% agarose gel electrophoresis using TAE buffer and excised from the gel and extracted using a MINELUTE® Gel Extraction Kit. The purified PCR product was used to generate a DIG-labeled probe as specified by the manufacturer's instructions using the initiators and amplification conditions specified above. The 0.5 kb DIG-labeled probe was purified by 1% agarose electrophoresis gel using TAE buffer and excised from the gel and extracted using a MINELUTE® Gel Extraction Kit. The probe was boiled for 5 minutes, cooled on ice for 2 minutes, and added to 10 mL of DIG Easy Hyb to produce a hybridization solution. Hybridization was carried out at 42 ° C for 15-17 hours. The membrane was then washed under conditions of low severity in SSC 2X and 0.1% SDS for 5 minutes at room temperature followed by two washes in high severity in SSC 0.5X and 0.1% SDS for 15 minutes each at 65 ° Ç. Probe-tagged hybrids were detected by chemiluminescence assay (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Southern analysis indicated that all spore isolates contained the repair / replacement cassette at the ku70 locus and were cured from the hpt and tk markers. A determined OSLOSS # 10B + Ku70 # 19L3 strain from T reesei was chosen for further transformations. Example 9: Construction of pDM286 that expresses a GH61A polypeptide from Penicillium sp.
[000373] The GH61 polypeptide from Penicillium sp. (emersonii). which encodes the sequence (SEQ ID NO: 7 [DNA sequence] and SEQ ID NO: 8 [deduced amino acid sequence]) was amplified from plasmid pGH61D23Y4 (WO 2011/041397) using the gene specific forward and reverse primers shown below. The italicized region represents vector homology with the insertion site for an IN-FUSION® reaction. Direct starter: 5'-CGG ^ CTGCGC74CCATGCTGTCTTCGACGACTCGCAC-3 '(SEQ ID NO: 67) Reverse starter: 5’-TCGCG4CGG ^ GCTTATCGACTTCTTCTAGAACGTC-3' (SEQ ID NO: 68)
[000374] The amplification reaction was composed of 30 ng of pGH61D23Y4 DNA, 50 pmoles of each of the primers listed below, 1 μL of a 10 mM mixture of dATP, dTTP, dGTP, and dCTP, DNA Start Polymerase Buffer IX PHUSION ™ High Fidelity Hot, and 1 unit of PHUSION ™ High Fidelity Hot Start DNA Polymerase in a final volume of 50 μL. The amplification reaction was incubated in a S EPPENDORF® MASTERCICLOR® 5333 epgradient programmed for 1 cycle at 98 ° C for 30 seconds; 35 cycles each at 98 ° C for 10 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds; and 1 cycle at 72 ° C for 10 minutes. The PCR products were separated by 1% agarose gel electrophoresis using TAE buffer where an approximately 0.9 kb fragment excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit according to the manufacturer's protocol.
[000375] Plasmid pMJ09 (WO 2005/047499) was digested with Nco I and Pac I, isolated by electrophoresis in 1.0% agarose gel in 1 mM disodium EDTA buffer - 50 mM Tris base - 50 mM botic acid ( TBE), excised from the gel, and extracted using a QIAQUICK® gel extraction kit according to the manufacturer's instructions.
[000376] The 0.9 kb PCR product was inserted into the gel-purified Nco I / PacI-digested pMJ09 using an IN-FUSION ™ Advantage PCR Cloning Kit according to the manufacturer's protocol. The IN-FUSION ™ reaction was composed of Reaction IX IN-FUSION ™ buffer, 180 ng of the pMJ09 digested by gel-purified Nco I / PacI, 108 ng of the 0.9 kb PCR product, and 1 μL of Enzyme IN-FUSION ™ in a reaction volume of 10 μL. The reaction was incubated for 15 minutes at 37 ° C followed by 15 minutes at 50 ° C. After the incubation period, 40 μL of TE were added to the reaction. A 2 μL aliquot was used to transform competent One SHOT® TOP 10 cells according to the manufacturer's protocol. E. coli transformation reactions were spread on 2XYT and ampicillin plates. Transformants were selected by sequencing and a clone containing the insert without any error-prone PCR was identified and pDM286 determined (Figure 4). Plasmid pDM286 can be digested with Pme I to generate an approximately 5.4 kb fragment for the transformation of T. reesei. The 5.4 kb fragment contains the expression cassette composed of the promoter of the T. reesei Cel7A cellobiohydrolase I gene, P. emersonii GH61A polypeptide encoding the sequence, and the T. reesei Cel7A cellobiohydrolase I terminator gene. The 5.4 kb fragment also contains the Aspergillus nidulans acetamidase (amdS) gene. Example 10: Generation of a Trichoderma reesei expression vector that encodes the mutant beta-glucosidase gene of Aspergillus fumigatus (Cel3A)
[000377] A beta-glycosidase variant of the Aspergillus fumigatus 3A family containing the G142S, Q183R, H266Q, and D703G substitutions was constructed by performing mutagenesis directed to the pEJG97 site (WO 2005/074647) using a QUIKCHANGE site mutagenesis kit ® Multi (Stratagene, La Jolla, CA, USA). A summary of the oligos used for site-directed mutagenesis is shown in table 1.
[000378] The resulting variant plasmid, pDFngl28-6, was prepared using a BIOROBOT® 9600 (QIAGEN Inc., Valencia, CA, USA). The construct of the variant plasmid was sequenced using an Applied Biosystems 3130x1 genetic analyzer (Applied Biosystems, Foster City, CA, USA) to verify the changes. TABLE 1

[000379] Two synthetic primers shown below were designed to amplify PCR of the mutant beta-glycosidase coding sequence of Aspergillus fumigatus from plasmid pDFng 128-6. An IN-FUSION ™ cloning kit was used to clone the fragment directly into the pMJ09 expression vector. Bold letters represent the coding sequence. The remaining sequence is homologous with the pMJ09 insertion sites. Direct initiator: 5 -CGGACTGCGCACCATGAGATTCGGTTGGCTCGA-3 ’(SEQ ID NO: 73) Reverse initiator: 5-TCGCCACGGAGCTTACTAGTAGACACGGGGCAGAG-3’ (SEQ ID NO: 74)
[000380] Fifty picomoles from each of the previous primers were used in a PCR reaction composed of 50 ng of pDFng 128-6, IX EXPAND® high-fidelity PCR buffer with MgCL (Roche Diagnostics Corporation, Indianapolis, IN, USA) , 0.25 mM each of dATP, dTTP, dGTP, and dCTP, and 2.6 units of high-fidelity enzyme mixture EXPAND® (Roche Diagnostics Corporation, Indianapolis, IN, USA) in a final volume of 50 μL . Amplification was performed on an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 94 ° C for 2 minutes; 30 cycles each at 94 ° C for 15 seconds, 65 ° C for 30 seconds, and 68 ° C for 1 minute; and a final stretch at 68 ° C for 7 minutes. The heated block was then left on an immersion cycle at 4 ° C. The reaction products were isolated by electrophoresis on 0.7% agarose gel in TBE buffer, where an approximately one flock of the 3.1 kb product was observed on the gel. The PCR reaction was purified using a QIAQUICK® gel extraction kit according to the manufacturer's instructions.
[000381] Plasmid pMJ09 was digested with Neo I and Pac I, isolated by electrophoresis in 1.0% agarose gel in TBE buffer, excised from the gel, and extracted using a QIAQUICK® gel extraction kit according to manufacturer's instructions.
[000382] The 3.1 kb gene fragment and the digested vector were ligated together using a resulting In-FUSION ™ cloning kit in pDFngl 13-3 (Figure 5), in which the transcription of the beta-glucosidase mutant that the sequence encoding was in control of a promoter from the Trichoderma reesei cbhl gene. The ligation reaction (20 μL) was composed of buffer IX IN-FUSION ™, BSA IX, 1 μL of IN-FUSION ™ enzyme (diluted 1:10), 200 ng of gel-purified pMJ09 and digested with Nco VPac I, and 172.2 ng of the purified 3.1 kb PCR product. The reaction was incubated at 37 ° C for 15 minutes followed by 50 ° C for 15 minutes. Two μL of the reaction was used to transform supercompetent E. coli XL 10 SOLOPACK® Gold cells (Stratagene, La Jolla, CA, USA). The E. coli transformation reactions were spread on 2XYT and ampicillin plates. An E. coli transformant containing pDFngl33-3 was prepared using a BIOROBOT® 9600. The beta-glucosidase of the Aspergillus fumigatus mutant inserted into pDFngl33 was confirmed by DNA sequencing. Example 11: Construction of plasmid pSMail39
[000383] To construct pSMail39, the full size coding region of Humicola insolens endoglucanase V was amplified by PCR from pMJ05 (US 2004/0248258 A1) as a template, with the primers shown below. The underlined portions are the Sph I and Hind III sites introduced by the direct primer Car-F2. The bold portion is an Eco RI site introduced by the antisense primer Car-R2. Car-F2 sense primer: 5'-TATAAGCTTAAGCATGCGTTCCTCCCCCCTC-3 '(SEQ ID NO: 75) Car-F2 antisense primer: 5'-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3 ’(SEQ ID NO: 76)
[000384] Amplification reactions (50 μL) were composed of ThermoPol IX reaction buffer (New England Biolabs, Inc., Ipswich, MA USA), 0.3 mM dNTPs, 10 ng pMJ05 DNA, 0.3 μM Car-F2 sense primer, 0.3 μM Car-R2 antisense primer, and 2.5 units of VENT® DNA polymerase (New England Biolabs, Inc., Ipswich, MA USA). The reactions were incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 30 cycles each at 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 60 seconds (15 minutes of final extension). The reaction products were isolated by electrophoresis on 1.0% agarose gel using TAE buffer, where a 900 bp product band was excised from the gel and purified using a QIAQUICK® gel extraction kit according to the instructions of the manufacturer. The 900 bp PCR fragment was then digested with Eco RI and Hind III and submitted to a QIAQUICK® PCR purification kit (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's protocol.
[000385] Plasmid pMJ05 was digested with Eco RI and Hind III, isolated by electrophoresis in 0.7% agarose gel in TAE buffer, excised from the gel and extracted using a QIAQUICK® gel extraction kit according to the instructions manufacturer.
[000386] The 900 bp PCR fragment digested with Eco RI and Hind III was ligated using T4 DNA ligase (Roche, Indianapolis, IN, USA) in pMJ05 digested with Eco RI and Hind III. The ligation reaction was composed of 50 ng of pMJ05 digested with Eco RI and Hind III, 33 ng of 0.9 kb PCR fragment digested with Eco RI and Hind III, IX Ligase buffer (Roche, Indianapolis, IN, USA) , and 2 units of T4 DNA ligase in a final volume of 20 μL. The reaction was incubated at 15 ° C for 17 hours and 2 μL of the reaction was used to transform competent ONE SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were exposed to thermal shock at 42 ° C for 30 seconds and 250 μL of SOC medium were added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 150 mm diameter plates with 2XYT and ampicillin and incubated at 37 ° C overnight. The resulting transformants were selected by digestion analysis with restriction with Sph I and Bam Hl to determine the presence and orientation of the insertion, and the positive clones were sequenced. A clone containing the endoglucanase V coding region of Humicola insolens without any PCR error was determined pSMail39 (Figure 6). Example 12: Construction of plasmid pSMail43
[000387] Plasmid pSMail43 was constructed by amplifying 620 bp of the cellobiohydrolase promoter CelóA from Trichoderma reesei from the genomic DNA of Trichoderma reesei RutC30, using primers 994148 and 994149 shown below. And the underlined portion is a Sal I site introduced by the 994148 primer. The bold portion is a “CAT” string introduced by the 994149 primer. 994148 Primer: 5'-ACGCGTÇGAÇGAATTCTAGGCTAGGTATGCGAGGCA-3 '(SEQ ID NO: 77) Initiator 994149: 5 '-CATGGTGCAATACACAGAGGGTG-3' (SEQ ID NO: 78)
[000388] Amplification reactions (50 μL) were composed of IX ThermoPol reaction buffer, 0.3 mM dNTPs, 100 ng genomic DNA from Trichoderma reesei RutC30, sense primer 994148 0.3 μM, antisense primer 994149 0 , 3 μM, and 2.5 units of Vent DNA polymerase. The reactions were incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 30 cycles each at 94 ° C for 60 seconds, 55 ° C for 60 seconds, and 72 ° C for 60 seconds (15 minutes of final extension). The reaction products were isolated by electrophoresis on 1.0% agarose gel using TAE buffer, where a band of 620 bp product was excised from the gel and purified using a QIAQUICK® gel extraction kit according to the instructions of the manufacturer.
[000389] Plasmid pSMail39 was digested with Sph I, 3 'blunt end projecting with T4 DNA polymerase, and then digested with Sal I. Digested DNA was isolated by 0.7% agarose gel electrophoresis in TAE buffer, excised from the gel and extracted using a QIAQUICK® gel extraction kit according to the manufacturer's instructions.
[000390] The 620 bp PCR fragment digested with Sal I was ligated using T4 DNA ligase in pSMail39 digested with Sph I and Sal I. The ligation reaction was composed of 50 ng of pSMai! 39 digested with Sph I and Sal I , 22 ng of the 0.62 kb PCR fragment digested with Sal I, Ligase IX buffer, and 2 units of T4 DNA ligase in a final volume of 20 μL. The reaction was incubated at 15 ° C for 17 hours and 2 μL of the reaction was used to transform competent ONE SHOT® TOP 10 cells according to the manufacturer's protocol. The cells were exposed to thermal shock at 42 ° C for 30 seconds and 250 μL of SOC medium were added. The tubes were incubated at 37 ° C, 200 rpm for 1 hour and 250 μL were plated on 150 mm diameter plates with 2XYT and ampicillin and incubated at 37 ° C overnight. The resulting transformants were selected by digestion analysis with restriction with Eco RI to determine the presence and orientation of the insertion, and the positive clones were sequenced. A clone containing the cellobiohydrolase promoter Cel6A from Trichoderma reesei without any PCR error was determined pSMail43 (Figure 7). Example 13: Construction of plasmid pAG121
[000391] The expression vector pAGI21 with a Neo I restriction site was constructed by performing site-directed mutagenesis in pSMail43 (Example 12), using a QUIKCHANGE® site-mutagenesis kit (Stratagene, La Jolla, CA, USA) using initiators shown below. Mutagenesis was performed according to the manufacturer's recommendations, using 20 ng of plasmid pAG121 and 12.5 μM primers in a final volume of 50 μL. Smail43 SDM Fwd: gtgtattgcaccatggcgttcctcccccctcc (SEQ ID NO: 79) Smail43 SDM Rev ggaggggggaggaacgccatggtgcaataca (SEQ ID NO: 80)
[000392] The resulting variant plasmid pAGI21 was prepared using a BIOROBOT® 9600. The variant plasmid construct was sequenced using an Applied Biosystems 3130x1 genetic analyzer to verify changes. Example 14: Construction of a Trichoderma reesei expression vector, pSMai229, which encodes a mutant beta-glucosidase (Cel3A) gene from Aspergillus fumigatus
[000393] A Trichoderma reesei expression vector, pSMai229, which encodes the mutant Aspergillus fumigatus (Cel3A) beta-glucosidase of example 9, was constructed from pDFngl33-3 (Example 10) and pAG121 (Example 13).
[000394] The beta-glucosidase of the Aspergillus fumigatus mutant (Cel3A) was amplified by PCR, from pDFngl33-3, using primers 0611689 and 0611690 shown below. The bolded regions represent homology of pAG121 vector with the insertion site for INFUSION® cloning. Initiator 0611689: CACCCTCTGTGTATTGCACCATGAGATTCGGTTGGCTCGA (SEQ ID NO: 81) Initiator 0611690: TTCGCCACGGAGCTACTAGTCTAGTAGACACGGGGCAGAG (SEQ ID NO: 82)
[000395] The amplification reaction was composed of 25 ng of pDFngl33-3 DNA, 200 μM dNTP's, 0.4 μM primers, PHUSION® IX buffer, and 1 unit of PHUSION® Hot Start high-fidelity DNA polymerase in one volume end of 50 μL. The amplification reaction was incubated in an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 98 ° C for 30 seconds; 30 cycles each at 98 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 ° C for 3 minutes 30 seconds; and 1 cycle at 72 ° C for 15 minutes.
[000396] The PCR products were separated by electrophoresis on 1% agarose gel using TAE buffer, where a 3100 bp fragment was excised from the gel and purified using a MINELUTE® gel extraction kit according to the manufacturer's instructions. . The fragment was then cloned into the largest fragment of pAG121 digested with Ncol and Spel, using an IN-FUSION ™ Advantage PCR PCR cloning kit that results in pSMai229 (Figure 8). The ligation reaction (10 μL) was composed of IN-FUSION ™ IX buffer, 1 μL of IN-FUSION ™ enzyme, 100 ng of pAG121 digested with Nco I and Spe I, and 142 ng of 3100 bp purified PCR product . The reaction was incubated at 37 ° C for 15 minutes, followed by 15 minutes at 50 ° C. After diluting the reaction mixture with 50 μL of TE buffer (pH 8), 2.5 μL of the reaction was used to transform competent E. coli ONE SHOT® TOP 10 cells according to the manufacturer's protocol. An E. coli transformant containing pSMai229 was detected by restricted digestion and plasmid DNA was prepared using a BIOROBOT® 9600. The insertion of the beta-glucosidase mutant from Aspergillus fumigatus (Cel3A) into pSMai229 was confirmed by DNA sequencing. Example 15: Co-transformation of pDM286 and pSMai229 into Trichoderma reesei 981-O-8.5 # 10B + Ku70 # 19L3
[000397] The preparation of the protoplast and transformation of Trichoderma reesei cepa 981-0-8.5 # 10B + Ku70 # 19L3 were carried out in the manner described in Example 2.
[000398] Approximately 100 μg of pDM286 and pSMai229 were digested with Pme I. Each digestion reaction was purified by electrophoresis on 1% agarose gel in TAE buffer, a DNA band was excised from the gel and extracted using an extraction kit QIAQUICK® gel. The transformation was carried out by adding 0.7-1.7 μg of pSMai229 purified on gel and digested with Pme I, and 0.7-2.0 μg of pDM286 in 100 μL of Trichoderma reesei, T. reesei 981 -O-8 # 10B + Ku70 # 19L3, and mixed gently. PEG buffer (250 μL) was added, mixed and incubated at 34 ° C for 30 minutes. STC (4 mL) was then added, mixed and plated on COVE plates. The plates were incubated at 28 ° C for 7-10 days. After a single cycle of spore purification in COVE2 and 10 mM uridine plates, 362 transformants were grown in 125 ml bottom-shaking flasks, containing 25 ml of cellulase induction medium, for 5 days at 28 ° C with stirring at 200 rpm. Samples of the culture broth were removed 5 days after inoculation, centrifuged at 2,000 rpm for 20 minutes, and the supernatants were transferred to new tubes and stored at -20 ° C until the enzyme assay.
[000399] Supernatants were assayed for beta-glucosidase activity using / j-nitrophenyl-beta-D-glucopyranoside as a substrate. Briefly, the culture supernatants were appropriately diluted in 0.1 M succinate buffer - TRITON® X-100 0.01% pH 5.0 (sample buffer), followed by a serial dilution from 0 times to 1 / 3 times the 1/9 time of the diluted sample. The T. reesei RutC30 fermentation broth was initially diluted 1/64, followed by 2-fold dilution steps up to a 16-fold dilution in the sample buffer to establish the linear assay range. A total of 20 μL of each dilution was transferred to a flat-bottom 96-well plate. Two hundred microliters of a 1 mg / mL / j-nitrophenyl-beta-D-glucopyraniside substrate buffer in 0.1 M succinate pH 5.0 was added to each well, and then incubated at room temperature for 45 minutes. Upon termination of the incubation period, 50 μL of the termination solution (Tris buffer 1 M pH 9) was added per well. An end point was measured at an optical density of 405 nm for the 96-well plate. The activity of the sample activity was determined according to the following equation: ((((OD405 / ec) * lxl06) / incubation time) / sample volume, where ec = l 7,749, incubation period = 45 minutes, and volume of the sample. sample = 0.02 ml.
[000400] Numerous transformants showed beta-glucosidase activity many times greater than that of Trichoderma reesei 981-0- 8.5 # 10B + Ku70 # 19L3. All samples with beta-glucosidase activity values greater than 7,000 μM / min / mL were analyzed by SDS-PAGE using CRITERION® 8-16% Tris-HCl gels (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with a CRITERION® Cell (Bio-Rad Laboratories, Inc. Hercules, CA, USA) to determine expression of the GH61A polypeptide from Penicillium emersonii. Five μL of 5-day samples were suspended in a 2X concentration of Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA), and heated at 95 ° C for 5 minutes in the presence of 5% beta-mercaptoethanol. All samples were placed in the 8-16% Tris-HCl CRITERION® gels and subjected to electrophoresis in Tris / Glycine / SDS IX running buffer (Bio-Rad Laboratories, Hercules, CA, USA). The resulting gels were stained with BIO-SAFE® Coomassie dye (Bio-Rad Laboratories, Hercules, CA, USA). The SDS-PAGE profiles of cultures showed the presence of both Aspergillus fumigatus variant beta-glucosidase and Penicillium emersonii GH61A in samples # 1, 64, 79, 82, 83, 116, 147, 167, 193, 198,210,219, 908 , 922, 928, 930, 935,951,963, and 980. Example 16: Construction of pAG57
[000401] The strain Aspergillus fumigatus NN051616 GH3 beta-xylosidase (SEQ ID NO: 15 [DNA sequence] and SEQ ID NO: 16 [deduced amino acid sequence]) was recombinantly repaired according to the following procedure.
[000402] Two synthetic primers shown below were determined to PCR amplify the Aspergillus fumigatus beta-xylosidase gene from genomic DNA. Genomic DNA was prepared in the manner described in example 1. A cloning kit for PCR IN-FUSION ™ Advantage was used to clone the fragment directly into the expression vector, pAILo2 (WO 2005/074647), without the need for restricted digestion. and connection. Direct initiator: 5-ACTGGATTTACCATGGCGGTTGCCAAATCTATTGCT-3 '(SEQ ID NO: 83) Reverse initiator: 5 -TCACCTCTAGTTAATTAATCACGCAGACGAAATCTGCT-3 ’(SEQ ID NO: 84)
[000403] The bold letters represent the sequence encoding. The remaining sequence is homologous to the pAlLo2 insertion sites.
[000404] Fifteen picomoles from each of the previous primers were used in a PCR reaction containing 250 ng genomic DNA from Aspergillus fumigatus, IX EXPAND® high-fidelity PCR buffer with MgCb, 1 μL of a mixture of dATP, dTTP, dGTP, and 10 mM dCTP, and 0.75 units of EXPAND® high-fidelity enzyme mix in a final volume of 50 μL. Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 94 ° C for 2 minutes; 10 cycles each at 94 ° C for 15 seconds, 56.5 ° C for 30 seconds, and 72 ° C for 2 minutes; and 20 cycles each at 94 ° C for 15 seconds, 56.5 ° C for 30 seconds, and 72 ° C for 2 minutes and 5 seconds per successive cycle. The heated block was then maintained at 72 ° C for 7 minutes, followed by an immersion cycle at 4 ° C.
[000405] The reaction products were isolated by electrophoresis on 1.0% agarose gel using TAE buffer, where a band of the 2.4 kb product was excised from the gel and purified using a MINELUTE® gel extraction kit from according to the manufacturer's instructions.
[000406] The fragment was then cloned into pAlLo2 using an IN-FUSION ™ Advantage PCR cloning kit. The vector was digested with Nco I and Pac I. The fragment was purified by electrophoresis on 1% agarose gel using TAE buffer, excised from the gel and extracted using a QIAQUICK® gel extraction kit. The gene fragment and the digested vector were combined together in a reaction that results in the expression plasmid pAG57, in which the transcription of the beta-xylosidase from Aspergillus fumigatus encoding the sequence was in control of the NA2-tpi promoter (a hybrid of the promoters) from the genes for neutral alpha-amylase from Aspergillus niger and triose phosphate isomerase from Aspergillus oryzae). The reaction (20 μL) was composed of buffer IX EM-FUSION ™, BSA IX, 1 μL of INFUSION ™ enzyme (diluted EO), 182 ng of pAlLo2 digested with Nco I and Pac I, and 97.7 ng of the PCR product purified of beta-xylosidase from Aspergillus fumigatus. The reaction was incubated at 37 ° C for 15 minutes, followed by 15 minutes at 50 ° C. The reaction was diluted with 40 μL of TE buffer and 2.5 μL of the diluted reaction was used to transform competent E. coli TOP 10 cells. An E. coli transformant containing pAG57 (Figure 9) was identified by digestion with restriction, and plasmid DNA was prepared using a B1OROBOT® 9600. The plasmid construct pAG57 was sequenced using an Applied Biosystems 3130x1 genetic analyzer to verify the sequence. Example 17: Construction of pDFngl24-l that expresses a beta-xylosidase from Aspergillus fumigatus
[000407] Two synthetic primers shown below have been determined to PCR amplify the beta-xylosidase of Aspergillus fumigatus from pAG57 (Example 16). An IN-FUSION ™ Advantage PCR cloning kit was used to clone the fragment directly into the expression vector, pMJ09, without the need for restriction and ligation digestion. Direct initiator: 5'-CGGACTGCGCACCATGGCGGTTGCCAAATC-3 '(SEQ ID NO: 85) Reverse initiator: 5'-TCGCCACGGAGCTTATCACGCAGACGAAATCT-3' (SEQ ID NO: 86)
[000408] The bold letters represent the coding sequence. The rest of the sequence is homologous to the pMJ09 insertion sites.
[000409] Fifty picomoles from each of the previous primers were used in a PCR reaction composed of 100 ng of pAG57, high-fidelity PCR IX EXPAND® with MgCh, 0.25 mM of each of dATP, dTTP, dGTP , and dCTP, and 2.6 units of EXPAND® enzyme mixture in a final volume of 50 μL. Amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 epgradient S programmed for 1 cycle at 94 ° C for 2 minutes; 30 cycles each at 94 ° C for 15 seconds, 65 ° C for 30 seconds, and 72 ° C for 2 minutes; and a final stretch at 72 ° C for 7 minutes. The heated block was then maintained and an immersion cycle at 4 ° C.
[000410] The reaction products were isolated by electrophoresis on 0.7% agarose gel in TBE buffer, where a 2.4 kb product band was excised from the gel and purified using a QIAQUICK® gel extraction kit from according to the manufacturer's instructions.
[000411] Plasmid pMJ09 was digested with Neo I and Pac I, isolated by electrophoresis on 0.7% agarose gel in TBE buffer, and purified using a QIAQUICK® gel extraction kit according to the manufacturer's instructions.
[000412] The gene fragment and the digested vector were ligated together using a PCR cloning kit. IN-FUSION ™ Advantage, resulting in pDFngl24-l (Figure 10), in which the transcription of the beta-xylosidase encoding the sequence was in control of the promoter of the Trichoderma reesei cbhl gene. The ligation reaction (20 μL) was composed of buffer IX IN-FUSION ™, 1 μL of IN-FUSION ™ enzyme (diluted 1:10), 200 ng of pMJ09 digested with Neo I and Pae I, and 100 ng of the product of purified beta-xylosidase PCR. The reaction was incubated at 37 ° C for 15 minutes, followed by 50 ° C for 15 minutes. Two μL of the reaction was used to transform into supercompetent E. coli XL 10 SOLOPACK® Gold cells according to the manufacturer's instructions. An E. coli transformant containing pDFng 124-1 was prepared using a BIOROBOT® 9600. The insertion of Aspergillus fumigatus beta-xylosidase into pDFngl24-l was confirmed by DNA sequencing. Example 18: pSaMe-AFGHIO construct that expresses an Aspergillus fumigatus xylanase
[000413] Two synthetic primers shown below have been determined to PCR amplify Aspergillus fumigatus GH10 xylanase from pHyGeOOl (WO 2006/078256). An IN-FUSION ™ Advantage PCR cloning kit was used to clone the fragment directly into the expression vector, pMJ09, without the need for restriction and ligation digestion. Direct initiator: 5'-CGGACTGCGCACCATGGTCCATCTATCTTCATT-3 '(SEQ ID NO: 87) Reverse initiator: 5'-TCGCCACGGAGCTTATTACAGGCACTGTGAGTACC-3' (SEQ ID NO: 88)
[000414] The bold letters represent the coding sequence. The remaining sequence is homologous to the pMJ09 insertion sites.
[000415] Fifty picomoles from each of the previous primers were used in a PCR reaction composed of 50 ng of pHYGEOOl, 1 μL of a 10 mM mixture of dATP, dTTP, dGTP, and dCTP, 5 μL of DNA polymerase buffer 10X ACCUTAQ ™ (Sigma-Aldrich, St. Louis, MO, USA), and 5 units of ACCUTAQ ™ DNA polymerase (Sigma-Aldrich, St. Louis, MO, USA) in a final volume of 50 μL. An EPPENDORF® MASTERCYCLER® 5333 epgradient S was used to amplify the DNA fragment programmed for 1 cycle at 95 ° C for 2 minutes; and 30 cycles each at 94 ° C for 15 seconds, 55 ° C for 30 seconds, and 68 ° C for 1 minute. After 30 cycles, the reaction was incubated at 72 ° C for 10 minutes and then cooled to 4 ° C until further processing.
[000416] The reaction products were isolated by electrophoresis on 1.0% agarose gel using TAE buffer, where a band of the 1.4 kb product was excised from the gel and purified using a QIAQUICK® gel extraction kit of according to the manufacturer's instructions.
[000417] The 1.4 kb fragment was then cloned into pMJ09 using an IN-FUSION ™ cloning kit. Plasmid pMJ09 was digested with Nco I and Pac I and purified by agarose gel electrophoresis, as previously described. The gene fragment and the digested vector were linked together in a reaction that results in the expression plasmid pSaMe-AfGH10, in which the xylanase transcription encoding the sequence was in control of the T. reesei cbhl promoter gene. The ligation reaction (50 μL) was composed of buffer IX IN-FUSION ™, BSA IX, 1 μL of INFUSION ™ enzyme (diluted 1:10), 100 ng of pMJ09 digested with Nco I and Pac I, and 100 ng of xylanase from the purified Aspergillus fumigatus PCR product. The reaction was incubated at room temperature for 30 minutes. One μL of the reaction was used to transform E. coli XL 10 SOLOPACK® Gold cells. An E. coli transformant containing pSaMe-AfGHIO (Figure 11) was detected by restriction enzyme digestion, and plasmid DNA was prepared using a BIOROBOT® 9600. Aspergillus fumigatus xylanase DNA sequencing encoding the pSaMe sequence - AfGHlO was carried out using dye terminating chemistry (Giesecke et al., 1992, Journal of Virology Methods 38: 47-60) and walking primer strategy. Example 19: Generation of the Trichoderma reesei RutC30 strain that expresses Aspergillus fumigatus xylanase and Aspergillus fumigatus beta-xylidasidase
[000418] The preparation of the protoplast and transformation of Trichoderma reesei ceoa RutC30 were carried out in the manner described in example 2.
[000419] Approximately 100 μg of pSaMe-AFGHlO and pDFng 124-1 were digested with Pme I. Each digestion reaction was purified by electrophoresis in 0.65% agarose gel in TAE buffer, a DNA band was excised from the gel. and extracted using a QIAQUICK® gel extraction kit. The transformation was carried out by adding 2 μg of gel-purified pDFng 1241 and digested with Pme I, and 1.72 μg of pSaMe-AfGHIO to 100 μL of Trichoderma reesei strain RutC30 strain solution and mixed gently. PEG buffer (250 μL) was added, mixed and incubated at 34 ° C for 30 minutes. STC (6 mL) was then added, mixed and plated on COVE plates. The plates were incubated at 28 ° C for 7-10 days. After a single cycle of spore purification on plates of COVE2 and 10 mM uridine, 200 transformants were grown in shaking flasks with 125 mL bottom protrusions, containing 25 mL of cellulase induction medium for 5 days at 28 ° C with stirring at 200 rpm. The culture broth samples were removed 5 days after inoculation, centrifuged at 2,000 rpm for 20 minutes, and the supernatants were transferred to new tubes and stored at -20 ° C until the enzymatic assay.
[000420] Three to five μL of each supernatant were combined with 5 to 6 μL of Laemelli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) with 5% beta-mercaptoethanol in a 0.2 microcentrifuge tube mL, and boiled for 2 minutes at 95 ° C in an EPPENDORF® MASTERCYCLER® 5333 epgradient S. The samples were analyzed by SDS-PAGE using a CRITERION® gel with 8-16% Tris-HCl according to the manufacturer's instructions , and 10 μL of PRECISION PLUS ™ .47 / Blue Protein Standards (Bio-Rad Laboratories, Hercules, CA, USA). The gels were stained with BIO-SAFE® Coomassie dye.
[000421] Four strains were selected based on the high expression of the beta-xylosidase and xylanase polypeptides, and their purified spores added spores collected in a 10 μL inoculation loop in 1.5 mL of TWEEN® 20 to 0.01% . Spore dilutions of 1: 1,500 and 1: 150 were spread on 150 mm COVE plates and cultured for 4 days at 28 ° C. Four spores isolated per strain (total of 16 isolates) were obtained and transferred to COVE2 + 10 mM uridine plates and cultured at 28 ° C for 9 days. The shake bottle and SDS-PAGE procedures were repeated in the first cycle of spore isolates. Eight strains were selected based on the high expression of the beta-xylosidase and xylanase polypeptides, and the spores were purified in a second step in the manner described above, resulting in four spores isolated per strain (total of 32 isolates). The shake flask and SDS-PAGE procedures were repeated for the second isolated spore cylinder. The final strain was selected based on the high expression of beta-xylosidase and xylanase polypeptides and determined O6HY4. Example 20: Pre-treated corn residue hydrolysis test
[000422] The corn residue was pretreated at the U.S. Department of Energy National Renewable Energy Laboratory (NREL) using 1.4 wt.% Sulfuric acid at 165 ° C and 107 psi for 8 minutes. The water-insoluble solids in the pre-treated corn residue (PCS) contained 56.5% cellulose, 4.6% hemicelluloses, and 28.4% lignin. Cellulose and hemicellulose were determined by a two-stage sulfuric acid hydrolysis with subsequent analysis of sugars by high performance liquid comatrography, using standard analytical procedure NREL # 002. Lignin was determined gravimetrically after hydrolyzing the cellulose and hemicellulose fractions with sulfuric acid, using standard analytical procedure NREL # 003.
[000423] The ground and unwashed PCS was prepared by grinding the complete PCS sludge in a wet multi-utility grinder Cosmos ICMG 40 (EssEmm Corporation, Tamil Nadu, India).
[000424] PCS hydrolysis was conducted using 2.2 ml deep well plates (Axygen, Union City, CA, USA), in a total reaction volume of 1.0 ml. Hydrolysis was carried out with 50 mg of insoluble PCS solids per ml of 50 mM sodium acetate buffer pH 5.0, containing 1 mM manganese sulphate and several protein loads of various enzyme compositions (expressed as mg of protein per gram of cellulose). The enzymatic compositions were prepared and then added simultaneously to all wells, in a volume ranging from 50 μL to 200 μL, to a final volume of 1 mL in each reaction. The plates were then sealed using an ALPS-300 ™ hot plate sealer (Abgene, Epsom, UK), mixed thoroughly, and incubated at a specific temperature for 72 hours. All reported experiments were performed in triplicate.
[000425] After hydrolysis, the samples were filtered using a 96-well plate with 0.45 μm MULTISCREEN® filter (Millipore, Bedford, MA, USA) and the filtrates were analyzed and related to the sugar content, as described Next. When not used immediately, the filtered aliquots were frozen at -20 ° C. The sugar concentration of the samples diluted in 0.005 M H2SO4 was measured using a 4.6 x 250 mm AMINEX® HPX-87H column (Bio-Rad Laboratories, Inc., Hercules, CA, USA) by elution with 0.05% w / w of benzoic acid-0.005 M H2SO4 at 65 ° C, at a flow rate of 0.6 mL per minute, and quantification by integrating the signals of glucose, cellobiosis, and xylose from the detection of the refractive index ( CHEMSTATION®, AGILENT® 1100 HPLC, Agilent Technologies, Santa Clara, CA, USA) was calibrated by pure sugar samples. The resulting glucose and cellobiose equivalents were used to calculate the percentage of cellulose conversion for each reaction.
[000426] Glucose, cellobiosis, and xylose were measured individually. The measured sugar concentrations were adjusted to the appropriate dilution factor. In the case of unwashed PCS, the net concentrations of enzyme-produced sugars were determined by adjusting the measured sugar concentrations to the corresponding bottom of the sugar concentrations in unwashed PCS at zero time points. All HPLC data processing was performed using the MICROSOFT EXCEL ™ software (Microsoft, Richland, WA, USA).
[000427] The degree of conversion of cellulose to glucose was calculated using the following equation:% conversion = (glucose concentration / glucose concentration limited digestion) x 100. To calculate the total conversion, the glucose and cellobiose values were combined. The degree of total cellulose conversion was calculated using the following equation:% conversion = [glucose concentration] / [(concentration of glucose in a limit digest] x 100. In order to calculate the% conversion, a conversion point 100% was adjusted, based on a cellulase control (50 mg of Trichoderma reesei cellulase per gram of cellulose), and all values were divided by this number and then multiplied by 100. The triplicate data points were calculated average and standard deviation was calculated.
[000428] An enzyme composition comprising a cellobiohydrolase I from Aspergillus fumigatus', a cellobiohydrolase II from Aspergillus fumigatus', a beta-glucosidase variant of Aspergillus fumigatus', a GH61 polypeptide from Penicillium sp. having better cellulolytic activity, an Aspergillus fumigatus xylanase, and an Aspergillus fumigatus beta-xylidasidase (determined "enzyme composition # 1") were compared to an enzyme composition comprising a mixture of a GH10 xylanase from Aspergillus aculeatus (WO 94/021785) and a Trichoderma reesei cellulase preparation containing beta-glucosidase from Aspergillus fumigatus (WO 2005/047499) and GH61A polypeptide from Thermoascus aurantiacus (WO 2005/074656) (determined "enzyme composition # 2").
[000429] Upon completion of the hydrolysis assay, a graph of protein loading (mg EP / g cellulose) versus percentage conversion (%) was generated. Using linear interpolation, the protein load required to achieve a certain percentage of conversion can be determined. In this case, 80% conversion of glucan to glucose equivalents was chosen to determine relative improvements in enzyme composition 1, as compared to enzyme composition 2. The results of this assay shown in figure 12 indicate that enzyme composition 1 is capable of achieve 80% conversion with 4.1 mg EP / g cellulose, while enzyme composition 2 is able to achieve the same conversion target with 7.3 mg EP / g cellulose. This represents a 1.78-fold improvement in performance per milligram of protein per enzyme composition 1 over enzyme composition 2, or a 1.78-fold reduction in protein requirement to achieve 80% conversion.
[000430] The present invention is further described by the following numbered paragraphs: [1] An enzymatic composition, comprising: (i) a cellobiohydrolase I from Aspergillus fumigatus ', (ii) a cellobiohydrolase II from Aspergillus fumigatus', (iii) a beta glucosidase from Aspergillus fumigatus or a variant thereof; and (iv) a GH61 polypeptide from Penicillium sp. having better cellulolytic activity; or similar counterparts. [2] The enzymatic composition of paragraph 1, in which the cellobiohydrolase I of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2 ; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, for example, very high stringency conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 1 or the full length complement the same. [3] The enzymatic composition of paragraph 1, in which the cellobiohydrolase II of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4 ; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 3 or the full length complement the same. [4] The enzyme composition of paragraph 1, in which the beta-glucosidase of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO : 6; (ii) a beta-glucosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 6; (iii) a beta-glucosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 5; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 5 or the size complement total of it. [5] The enzyme composition of paragraph 1, wherein the beta-glucosidase variant comprises a substitution at one or more positions corresponding to positions 100, 283, 456, and 512 of the mature polypeptide of SEQ ID NO: 6, where the variant has beta-glucosidase activity. [6] The enzyme composition of paragraph 5, wherein the parental beta-glucosidase of the variant is (a) a polypeptide comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (b) a polypeptide that has at least 80% sequence identity to the mature polypeptide of SEQ ID NO: 6; (c) a polypeptide encoded by a polynucleotide that hybridizes under conditions of high or very high severity to (i) the sequence encoding the mature polypeptide of SEQ ID NO: 5, (ii) the DNAc sequence contained in the sequence encoding the mature polypeptide of SEQ ID NO: 5, or (iii) the full size complementary strand of (i) or (ii); (d) a polypeptide encoded by a polynucleotide that has at least 80% sequence identity with the sequence encoding the mature polypeptide of SEQ ID NO: 5 or the cDNA sequence thereof; or (e) a fragment of the mature polypeptide of SEQ ID NO: 6, which exhibits beta-glucosidase activity. [7] The enzyme composition of paragraph 5 or 6, where the variant has at least 80%, for example, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, of sequence identity with the parental beta-glucosidase amino acid sequence. [8] The enzyme composition of any of paragraphs 5-7, wherein the variant has at least 80%, for example, at least 81%, at least 82%, at least 83%, at least 84%, at least 85 %, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% sequence identity with the mature polypeptide of SEQ ID NO: 6. [9] The enzyme composition of any paragraphs 5-8, where the number of substitutions is 1-4, such as 1, 2, 3, or 4 substitutions. [10] The enzymatic composition of any of paragraphs 5-9, wherein the variant comprises a substitution in a position corresponding to position 100, a substitution in a position corresponding to position 283, a substitution in a position corresponding to position 456, and / or a substitution in a position corresponding to position 512. [11] The enzymatic composition of paragraph 10, where the substitution in the position corresponding to position 100 is Ser; the substitution in the position corresponding to position 456 is Gly; the substitution in the position corresponding to position 456 is Gin; and the substitution in the position corresponding to position 512 is Gly. [12] The enzyme composition of any of paragraphs 5 11, wherein the variant comprises one or more (several) substitutions selected from the group consisting of G142S, Q183R, H266Q, and D703G. [13] The enzyme composition of any of paragraphs 5 to 12, wherein the variant comprises the substitutions G142S and Q183R; G142S and H266Q; G142S and D703G; Q183R and H266Q; Q183R and D703G; H266Q and D703G; G142S, Q183R, and H266Q; G142S, Q183R, and D703G; G142S, H266Q, and D703G; Q183R, H266Q, and D703G; or G142S, Q183R, H266Q, and D703G. [14] The enzymatic composition of paragraph 1, in which the GH61 polypeptide from Penicillium sp. Having better cellulolytic activity or homologous to it is selected from the group consisting of: (i) a GH61 polypeptide having better cellulolytic activity that comprises or consists of in the mature polypeptide of SEQ ID NO: 6; (ii) a GH61 polypeptide having better cellulolytic activity that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 8; (iii) a GH61 polypeptide having better cellulolytic activity encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence encoding the polypeptide mature of SEQ ID NO: 7; and (iv) a GH61 polypeptide having better cellulolytic activity encoded by a polynucleotide that hybridizes under at least high severity conditions, for example, very high severity conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 7 or the full size complement of the same. [15] The enzyme composition of any of paragraphs 1-14, which further comprises one or more enzymes selected from the group consisting of: (i) an Aspergillus fumigatus xylanase or homologue thereof, (ii) an Aspergillus beta-xylidase fumigatus or its counterpart; or (iii) a combination of (i) and (ii). [16] The enzyme composition of paragraph 15, in which the Aspergillus fumigatus xylanase or homologue thereof is selected from the group consisting of: (i) an Aspergillus fumigatus xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14; (ii) a xylanase comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12 , or SEQ ID NO: 14; (iii) a xylanase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID NO polypeptide : 9, SEQ ID NO: 11, or SEQ ID NO: 13; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least high stringency conditions, for example, very high stringency conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13; or the full size complement of it. [17] The enzyme composition of paragraph 15, in which the beta-xylosidase of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO : 16; (ii) a beta-xylosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 16; (iii) a beta-xylosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 15; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes in at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 15 or the size complement total of it. [18] The enzyme composition of any of paragraphs 1-17, which further comprises one or more enzymes selected from the group consisting of a cellulase, a GH61 polypeptide having better cellulolytic activity, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin. [19] The enzyme composition of paragraph 18, in which cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase. [20] The enzyme composition of paragraph 19, where the endoglucanase is an endoglucanase I. [21] The enzyme composition of paragraph 19, where the endoglucanase is an endoglucanase II. [22] The enzyme composition of paragraph 18, in which hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase. [23] A recombinant filamentous fungus host cell, comprising polynucleotides that encode: (i) an Aspergillus fumigatus cellobiohydrolase I, (ii) an Aspergillus fumigatus cellobiohydrolase II, (iii) an Aspergillus fumigatus or beta-glucosidase variant or of this; and (iv) a GH61 polypeptide from Penicillium sp. having better cellulolytic activity; or similar counterparts. [24] The host cell of the recombinant filamentous fungus of paragraph 23, in which the Aspergillus fumigatus cellobiohydrolase I or homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature SEQ polypeptide ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 1 or the full length complement the same. [25] The host cell of the recombinant filamentous fungus of paragraph 23, in which the cellobiohydrolase II of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature SEQ polypeptide ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 3 or the full size complement the same. [26] The host cell of the recombinant filamentous fungus of paragraph 23, in which the beta-glucosidase of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a beta-glucosidase that comprises or consists of the mature polypeptide SEQ ID NO: 6; (ii) a beta-glucosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 6; (iii) a beta-glucosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 5; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 5 or the size complement total of it. [27] The recombinant filamentous fungus host cell of paragraph 23, wherein the beta-glucosidase variant comprises a substitution at one or more positions corresponding to positions 100, 283, 456, and 512 of the mature polypeptide of SEQ ID NO: 6, in which the variant has beta-glucosidase activity. [28] The host cell of the recombinant filamentous fungus of paragraph 27, wherein the parental beta-glucosidase of the variant is (a) a polypeptide comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (b) a polypeptide that has at least 80% sequence identity to the mature polypeptide of SEQ ID NO: 6; (c) a polypeptide encoded by a polynucleotide that hybridizes under conditions of high or very high severity to (i) the sequence encoding the mature polypeptide of SEQ ID NO: 5, (ii) the DNAc sequence contained in the sequence encoding the mature polypeptide of SEQ ID NO: 5, or (iii) the full size complementary strand of (i) or (ii); (d) a polypeptide encoded by a polynucleotide that has at least 80% sequence identity with the sequence encoding the mature polypeptide of SEQ ID NO: 5 or the cDNA sequence thereof; or (e) a fragment of the mature polypeptide of SEQ ID NO: 6, which exhibits beta-glucosidase activity. [29] The host cell of the recombinant filamentous fungus of paragraph 27 or 28, in which the variant has at least 80%, for example, at least 81%, at least 82%, at least 83%, at least 84%, at least at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, of sequence identity with the parental beta-glucosidase amino acid sequence. [30] The recombinant filamentous fungus host cell of any of paragraphs 27-29, wherein the variant has at least 80%, for example, at least 81%, at least 82%, at least 83%, at least 84% at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94% at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% sequence identity with the mature polypeptide of SEQ ID NO: 6. [31] A recombinant filamentous fungus host cell of any of paragraphs 27-30, wherein the number of substitutions is 1-4, such as 1, 2, 3, or 4 substitutions. [32] The recombinant filamentous fungus host cell of any of paragraphs 27-31, wherein the variant comprises a substitution in a position corresponding to position 100, a substitution in a position corresponding to position 283, a substitution in one position corresponding to position 456, and / or a substitution in a position corresponding to position 512. [33] The recombinant filamentous fungus host cell of paragraph 32, where the substitution in the position corresponding to position 100 is Ser; the substitution in the position corresponding to position 456 is Gly; the substitution in the position corresponding to position 456 is Gin; and the substitution in the position corresponding to position 512 is Gly. [34] The recombinant filamentous fungus host cell of any of paragraphs 27-33, wherein the variant comprises one or more (several) substitutions selected from the group consisting of G142S, Q183R, H266Q, and D703G. [35] The recombinant filamentous fungus host cell of any of paragraphs 27-34, wherein the variant comprises the substitutions G142S and Q183R; G142S and H266Q; G142S and D703G; Q183R and H266Q; Q183R and D703G; H266Q and D703G; G142S, Q183R, and H266Q; G142S, Q183R, and D703G; G142S, H266Q, and D703G; Q183R, H266Q, and D703G; or G142S, Q183R, H266Q, and D703G. [36] The host cell of the recombinant filamentous fungus of paragraph 23, where the GH61 polypeptide from Penicillium sp. having better cellulolytic activity or homologous to it is selected from the group consisting of: (i) a GH61 polypeptide having better cellulolytic activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) a GH61 polypeptide having better cellulolytic activity that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 8; (iii) a GH61 polypeptide having better cellulolytic activity encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence encoding the polypeptide mature of SEQ ID NO: 7; and (iv) a GH61 polypeptide having better cellulolytic activity encoded by a polynucleotide that hybridizes under at least high severity conditions, for example, very high severity conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 7 or the full size complement of the same. [37] The recombinant filamentous fungus host cell of any of paragraphs 23-36, which further comprises one or more polynucleotides that encode one or more enzymes selected from the group consisting of: (i) an Aspergillus fumigatus xylanase, (ii ) a beta-xylosidase from Aspergillus fumigatus', and (iii) a combination of (i) and (ii). [38] The host cell of the recombinant filamentous fungus of paragraph 37, in which the Aspergillus fumigatus xylanase or homologue thereof is selected from the group consisting of: (i) an Aspergillus fumigatus xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14; (ii) a xylanase comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12 , or SEQ ID NO :; (iii) a xylanase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID NO polypeptide : 9, SEQ ID NO: 11, or SEQ ID NO: 13; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13; or the full size complement of it. [39] The recombinant filamentous phy host cell of paragraph 37, in which the beta-xylosidase of Aspergillus fumigatus or homologue thereof is selected from the group consisting of: (i) a beta-xylosidase that comprises or consists of the mature polypeptide SEQ ID NO: 16; (ii) a beta-xylosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 16; (iii) a beta-xylosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 15; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes in at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 15 or the size complement total of it. [40] The recombinant filamentous fungus host cell of any of paragraphs 23-39, which is a Trichoderma cell. [41] The host cell of the recombinant filamentous fungus of paragraph 40, in which the Trichoderma cell is selected from the group consisting of Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride. [42] The host cell of the recombinant filamentous fungus of paragraph 40, which is Trichoderma reesei. [43] The recombinant filamentous fungus host cell of any of paragraphs 23-42, where one or more of the cellulase genes, one or more of the hemicellulase genes, or a combination thereof, endogenous to the filamentous fungus host cell were inactivated. [44] The recombinant filamentous fungus host cell of paragraph 43, in which a cellobiohydrolase I gene has been inactivated. [45] The host cell of the recombinant filamentous fungus of paragraph 44, wherein the cellobiohydrolase I gene encodes a cellobiohydrolase I selected from the group consisting of: (i) a cellobiohydrolase I that comprises or consists of the mature polypeptide of SEQ ID NO : 18; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 18; (iii) a cellobiohydrolase I encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 17; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 17 or the full length complement the same. [46] The recombinant filamentous fungus host cell of any of paragraphs 43-45, in which a cellobiohydrolase II gene has been inactivated. [47] The recombinant filamentous fungus host cell of paragraph 46, in which the cellobiohydrolase II gene encodes a cellobiohydrolase II selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO : 20; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 20; (iii) a cellobiohydrolase II encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 19; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 19 or the full size complement the same. [48] The recombinant filamentous fungus host cell of any of paragraphs 43-47, in which a beta-glucosidase gene has been inactivated. [49] The host cell of the recombinant filamentous fungus of paragraph 48, in which the beta-glucosidase gene encodes a beta-glucosidase selected from the group consisting of: (i) a beta-glucosidase that comprises or consists of the mature polypeptide of SEQ ID NO: 22; (ii) a beta-glucosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83 %, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 22; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 21; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 21 or the size complement total of it. [50] The recombinant filamentous fungus host cell of any of paragraphs 43-49, in which a xylanase I gene has been inactivated. [51] The recombinant filamentous fungus host cell of paragraph 50, in which the xylanase I gene encodes a xylanase I selected from the group consisting of: (i) a xylanase I comprising or consisting of the mature polypeptide of SEQ ID NO : 24; (ii) a xylanase I comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 24; (iii) a xylanase I encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 23; and (iv) a xylanase I encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 23 or the full length complement the same. [52] The recombinant filamentous fungus host cell of any of paragraphs 43-51, in which a xylanase II gene has been inactivated. [53] The recombinant filamentous fungus host cell of paragraph 52, wherein the xylanase II gene encodes a xylanase II selected from the group consisting of: (i) a xylanase II comprising or consisting of the mature polypeptide of SEQ ID NO : 26; (ii) a xylanase II comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 26; (iii) a xylanase II encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 25; and (iv) a xylanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, for example, very high stringency conditions, with the sequence encoding the mature polypeptide of SEQ ID NO: 25 or the full length complement the same. [54] The recombinant filamentous fungus host cell of any of paragraphs 43-53, in which a Trichoderma reesei xylanase III gene has been inactivated. [55] The host cell of the recombinant filamentous fungus of paragraph 54, in which the xylanase III gene encodes a xylanase III selected from the group consisting of: (i) a xylanase III comprising or consisting of the mature SEQ ID NO polypeptide : 28; (ii) a xylanase III comprising or consisting of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83% at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 28; (iii) a xylanase III encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ ID polypeptide NO: 27; and (iv) a xylanase III encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 27 or the full size complement the same. [56] The recombinant filamentous fungus host cell of any of paragraphs 43-55, in which a beta-xylosidase gene has been inactivated. [57] The host cell of the recombinant filamentous fungus of paragraph 56, in which the beta-xylosidase gene encodes a beta-xylosidase selected from the group consisting of: (i) a beta-xylosidase that comprises or consists of the mature polypeptide of SEQ ID NO: 30 (ii) a beta-xylosidase that comprises or consists of an amino acid sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82 %, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 30; (iii) a beta-xylosidase encoded by a polynucleotide that comprises or consists of a nucleotide sequence that has at least 70%, for example, at least 75%, at least 80%, at least 81%, at least 82% at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence encoding the mature SEQ polypeptide ID NO: 29; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least conditions of high severity, for example, conditions of very high severity, with the sequence encoding the mature polypeptide of SEQ ID NO: 29 or the size complement total of it. [58] The recombinant filamentous fungus host cell of any of paragraphs 23-55, which further comprises one or more polynucleotides that encode one or more enzymes selected from the group consisting of a cellulase, a GH61 polypeptide having better cellulolytic activity, a hemicellulase , an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin. [59] The host cell of the recombinant filamentous fungus of paragraph 58, in which cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase. [60] The host cell of the recombinant filamentous fungus of paragraph 58, in which hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, an xylidasidase, and a glucuronidase. [61] The recombinant filamentous fungus host cell of any of paragraphs 58-60, wherein one or more of the enzymes are natural to the filamentous fungus host cell. [62] The recombinant filamentous fungus host cell of paragraph 61, wherein the natural enzyme in the filamentous fungus host cell is an endoglucanase. [63] The recombinant filamentous fungus host cell of paragraph 62, where the endoglucanase is an endoglucanase I. [64] The recombinant filamentous fungus host cell of paragraph 62, where the endoglucanase is an endoglucanase II. [65] A method of producing an enzyme composition, comprising: (a) cultivating the host cell of any of paragraphs 23-64 under conditions that lead to the production of the enzyme composition; and optionally (b) recovering the enzyme composition. [66] A process for degrading a cellulosic material, comprising: treating the cellulosic material with the enzymatic composition of any of paragraphs 1-22. [67] The process in paragraph 66, in which the cellulosic material is pre-treated. [68] The process of paragraph 66 or 67 further comprises recovering the degraded cellulosic material. [69] The process in paragraph 68, in which the degraded cellulosic material is sugar. [70] The process in paragraph 69, in which sugar is selected from the group consisting of glucose, xylose, mannose, galactose, and arabinose. [71] A process for synthesizing a fermentation product, comprising: (a) saccharifying a cellulosic material with the enzymatic composition of any of paragraphs 1-22; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to synthesize the fermentation product; and (c) recovering the fermentation product from the fermentation. [72] The process in paragraph 71, in which the cellulosic material is pre-treated. [73] The process in paragraph 71 or 72, in which steps (a) and (b) are performed simultaneously in simultaneous saccharification and fermentation. [74] The process of any of paragraphs 71-73, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide. [75] A process for fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with the enzymatic composition of any of paragraphs 1-22. [76] The process of paragraph 75, in which the fermentation of the cellulosic material synthesizes a fermentation product. [77] The process of paragraph 76 further comprises recovering the fermentation product from fermentation. [78] The process of paragraph 76 or 77, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide. [79] The process of any of paragraphs 75-78, in which the cellulosic material is pre-treated before saccharification. [80] The enzyme composition of paragraphs 47-49, further comprising a Trichoderma endoglucanase I, Trichoderma endoglucanase II, or Trichoderma endoglucanase I and Trichoderma endoglucanase II. [81] The enzyme composition of paragraph 80, wherein Trichoderma endoglucanase I is Trichoderma reesei endoglucanase I. [82] The enzyme composition of paragraph 80, wherein Trichoderma endoglucanase II is Trichoderma reesei endoglucanase II.
[000431] The invention described and claimed herein should not be limited in scope by the specific aspects disclosed herein, since these aspects are intended as illustrations of various aspects of the invention. Any equivalent aspect is intended to be within the scope of this invention. In fact, several modifications of the invention, in addition to those shown and described here, will become evident to those skilled in the art from the preceding description. Such modifications are also intended to be within the scope of the attached claims. In the event of a conflict, the present disclosure, including definitions, will prevail.

权利要求:
Claims (18)
[0001]
1. Enzymatic composition, characterized by the fact that it comprises: (i) a cellobiohydrolase I from Aspergillus fumigatus; (ii) a cellobiohydrolase II from Aspergillus fumigatus; (iii) a beta-glucosidase from Aspergillus fumigatus or a variant thereof; and (iv) a GH61 polypeptide from Penicillium sp. having better cellulolytic activity; wherein the cellobiohydrolase I of Aspergillus fumigatus consists of SEQ ID NO: 2 or the mature polypeptide of SEQ ID NO: 2; wherein the Aspergillus fumigatus cellobiohydrolase II consists of SEQ ID NO: 4 or the mature polypeptide of SEQ ID NO: 4; wherein the beta-glucosidase from Aspergillus fumigatus consists of SEQ ID NO: 6 or the mature polypeptide of SEQ ID NO: 6; wherein the beta-glucosidase variant of Aspergillus fumigatus consists of the substitutions F100D, S283G, N456E, and F512Y or the mature polypeptide of SEQ ID NO: 6, where the variant has beta-glucosidase activity; and wherein the GH61 polypeptide from Penicillium sp. having better cellulolytic activity consists of SEQ ID NO: 8 or the mature polypeptide of SEQ ID NO: 8.
[0002]
2. Enzymatic composition according to claim 1, characterized by the fact that it additionally comprises one or more enzymes selected from the group consisting of: (i) a xylanase from Aspergillus fumigatus, (ii) a beta-xylosidase from Aspergillus fumigatus; or (iii) a combination of (i) and (ii); wherein the Aspergillus fumigatus xylanase consists of SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14 or the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14 ; and wherein the beta-xylosidase of Aspergillus fumigatus consists of SEQ ID NO: 16 or the mature polypeptide of SEQ ID NO: 16.
[0003]
3. Enzymatic composition according to claim 1 or 2, characterized by the fact that it additionally comprises one or more enzymes selected from the group consisting of a cellulase, a GH61 polypeptide having better cellulolytic activity, a hemicellulase, an esterase, an expandin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin, in which cellulase is one or more enzymes selected from the group consisting of an endoglucanase I, an endoglucanase II, a cellobiohydrolase I, a cellobiohydrolase II , and a beta-glucosidase and in which hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.
[0004]
4. Enzyme composition according to claim 1 or 2, characterized in that it additionally comprises a Trichoderma reesei endoglucanase I, a Trichoderma reesei endoglucanase II, or a Trichoderma reesei endoglucanase I and a Trichoderma reesei endoglucanase II, in that Trichoderma reesei endoglucanase I consists of SEQ ID NO: 90 or the mature polypeptide of SEQ ID NO: 90 and Trichoderma endoglucanase II consists of SEQ ID NO: 92 or the mature polypeptide of SEQ ID NO: 92.
[0005]
5. Recombinant Trichoderma reesei host cell, characterized by the fact that it comprises polynucleotides that encode: (i) a cellobiohydrolase I from Aspergillus fumigatus; (ii) a cellobiohydrolase II from Aspergillus fumigatus; (iii) a beta-glucosidase from Aspergillus fumigatus or a variant thereof; and (iv) a GH61 polypeptide having better cellulolytic activity than Penicillium sp .; wherein the polynucleotide of SEQ ID NO: 1 or the polypeptide or coding sequence of SEQ ID NO: 1 encodes Aspergillus fumigatus cellobiohydrolase I consisting of SEQ ID NO: 2 or the mature polypeptide of SEQ ID NO: 2; wherein the polynucleotide of SEQ ID NO: 3 or the coding sequence for the mature polypeptide of SEQ ID NO: 3 encodes the cellobiohydrolase II of Aspergillus fumigatus consisting of SEQ ID NO: 4 or the mature polypeptide of SEQ ID NO: 4; wherein the polynucleotide of SEQ ID NO: 5 or the coding sequence for the mature polypeptide of SEQ ID NO: 5 encodes the beta-glucosidase of Aspergillus fumigatus consisting of SEQ ID NO: 6 or the mature polypeptide of SEQ ID NO: 6; wherein the polynucleotide of SEQ ID NO: 5 or the coding sequence for the mature polypeptide of SEQ ID NO: 5 comprises mutations encoding the beta-glucosidase variant of Aspergillus fumigatus consisting of the F100D, S283G, N456E, and F512Y substitutions of the mature polypeptide SEQ ID NO: 6, in which the variant has beta-glucosidase activity; and wherein the polynucleotide of SEQ ID NO: 7 or the coding sequence for the mature polypeptide of SEQ ID NO: 7 encodes the GH61 polypeptide having the best cellulolytic activity of Penicillium sp. consisting of SEQ ID NO: 8 or the mature polypeptide of SEQ ID NO: 8.
[0006]
A recombinant filamentous fungus host cell according to claim 5, characterized by the fact that it additionally comprises one or more polynucleotides that encode one or more enzymes selected from the group consisting of: (i) an Aspergillus fumigatus xylanase; (ii) a beta-xylosidase from Aspergillus fumigatus; and (iii) a combination of (i) and (ii); wherein the polynucleotide of SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13 or the coding sequence for the polypeptide of SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13 encodes xylanase Aspergillus fumigatus consisting of SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO 14 or the mature polypeptide of SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14; and wherein the polynucleotide of SEQ ID NO: 15 or the coding sequence for the mature polypeptide of SEQ ID NO: 15 encodes the beta-xylosidase of Aspergillus fumigatus consisting of SEQ ID NO: 16 or the mature polypeptide of SEQ ID NO: 16.
[0007]
7. Recombinant host cell according to claim 5 or 6, characterized in that one or more cellulase genes, one or more hemicellulase genes, or a combination thereof, endogenous to the filamentous fungus host cell have been inactivated; wherein one or more cellulase genes encode enzymes selected from the group consisting of a cellobiohydrolase I, cellobiohydrolase II, and a beta-glucosidase; wherein the cellobiohydrolase I gene of SEQ ID NO: 17 encodes cellobiohydrolase I selected from the group consisting of SEQ ID NO: 18 or the mature polypeptide of SEQ ID NO: 18; wherein the cellobiohydrolase II gene of SEQ ID NO: 19 encodes cellobiohydrolase II consisting of SEQ ID NO: 20; and wherein the beta-glucosidase gene of SEQ ID NO: 21 encodes beta-glucosidase consisting of SEQ ID NO: 22; wherein the one or more hemicellulases genes are selected from the group consisting of a xylanase I gene, a xylanase II gene, a xylanase III gene, and a beta-xylidasidase gene; wherein the xylanase I gene of SEQ ID NO: 23 encodes xylanase I consisting of SEQ ID NO: 24; wherein the xylanase II gene of SEQ ID NO: 25 encodes xylanase II consisting of SEQ ID NO: 26; wherein the xylanase III gene of SEQ ID NO: 27 encodes xylanase III consisting of SEQ ID NO: 28; and wherein the beta-xylosidase gene of SEQ ID NO: 29 encodes beta-xylosidase consisting of that in SEQ ID NO: 30.
[0008]
8. Recombinant host cell according to any one of claims 5 to 7, characterized in that it additionally comprises one or more polynucleotides that encode one or more enzymes selected from the group consisting of a cellulase, a GH61 polypeptide having better cellulolytic activity, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swolenin, in which cellulase is one or more enzymes selected from the group consisting of an endoglucanase I, an endoglucanase II , a cellobiohydrolase I, a cellobiohydrolase II, and a beta-glucosidase, and where hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, an xylosidase, and an glucuronidase.
[0009]
9. Recombinant filamentous fungus host cell according to claim 8, characterized by the fact that one or more of the enzymes are native to the filamentous fungus host cell.
[0010]
10. Recombinant host cell according to any one of claims 5 to 9, characterized in that it further comprises polynucleotide (s) encoding a Trichoderma reesei endoglucanase I, a Trichoderma reesei endoglucanase II, or a Trichoderma reesei endoglucanase I a Trichoderma reesei endoglucanase II, wherein the polynucleotide of SEQ ID NO: 89 or the coding sequence of the mature polypeptide of SEQ ID NO: 89 encodes the endoglucanase I of Trichoderma reesei consisting of SEQ ID NO: 90 or the mature polypeptide of SEQ ID NO: 90 and the polynucleotide of SEQ ID NO: 91 or the coding sequence for the mature polypeptide of SEQ ID NO: 91 encodes Trichoderma endoglucanase II consisting of SEQ ID NO: 92 or the mature polypeptide of SEQ ID NO: 92.
[0011]
11. Method for producing an enzyme composition, characterized by the fact that it comprises: (a) cultivating the recombinant host cell as defined in any one of claims 5 to 10 under conditions for the production of the enzyme composition; and optionally (b) recovering the enzyme composition.
[0012]
12. Process for degrading a cellulosic material, characterized by the fact that it comprises: treating the cellulosic material with the enzymatic composition as defined in any one of claims 1 to 4; and optionally recovering the degraded cellulosic material.
[0013]
Process according to claim 12, characterized by the fact that the degraded cellulosic material is a sugar, preferably a sugar selected from the group consisting of glucose, xylose, mannose, galactose and arabinose.
[0014]
14. Process for synthesizing a fermentation product, characterized by the fact that it comprises: (a) saccharifying a cellulosic material with the enzymatic composition as defined in any one of claims 1 to 4; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to synthesize the fermentation product; and (c) recovering the fermentation product from the fermentation.
[0015]
15. Process according to claim 14, characterized by the fact that steps (a) and (b) are carried out simultaneously in simultaneous saccharification and fermentation.
[0016]
16. Process for fermenting a cellulosic material, characterized by the fact that it comprises: fermenting the cellulosic material with one or more fermenting microorganisms, in which the cellulosic material is saccharified with the enzymatic composition as defined in any of claims 1 to 4, and wherein the fermentation of the cellulosic material produces a fermentation product, and recovering the fermentation product from the fermentation.
[0017]
17. Process according to any one of claims 12 to 16, characterized in that the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid , or polyketide.
[0018]
18. Process according to any one of claims 12 to 17, characterized in that the cellulosic material is pre-treated before saccharification.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US11230723B2|2022-01-25|Cellulolytic enzyme compositions and uses thereof

---

EP2702162B1|2020-02-26|Methods for enhancing the degradation or conversion of cellulosic material

---

EP3382016B1|2019-10-09|Polypeptides having xylanase activity and polynucleotides encoding same

---

US9970015B2|2018-05-15|Aspergillus fumigatus cellulolytic enzyme compositions and uses thereof

---

US11174499B2|2021-11-16|Enzyme compositions and uses thereof

---

EP2782998B1|2018-01-10|Polypeptides having beta-xylosidase activity and polynucleotides encoding same

---

US20170166939A1|2017-06-15|Enzyme Compositions and Uses Thereof

---

BR112014014697A2|2020-10-27|isolated polypeptide, composition, isolated polynucleotide, nucleic acid construct or expression vector, recombinant host cell, methods for producing a polypeptide and a protein, for generating molecular oxygen, and for removing hydrogen peroxide from tissue, processes for degrading or converting a cellulosic material, and to produce a fermentation product, and, integral broth formulation or cell culture composition

同族专利:

---

公开号 | 公开日

---

US11230723B2|2022-01-25|

---

US20140308701A1|2014-10-16|

---

AU2017219076A1|2017-09-14|

---

DK2748305T3|2017-02-06|

---

US20190002941A1|2019-01-03|

---

EP2748305B1|2016-11-16|

---

AU2019200618B2|2021-07-22|

---

CN108179139A|2018-06-19|

---

AU2012298725C1|2017-11-02|

---

EP2748305A1|2014-07-02|

---

IN2014CN02100A|2015-05-29|

---

AU2017219076B2|2019-01-24|

---

US20190153494A1|2019-05-23|

---

AU2019200618A1|2019-02-21|

---

CN103890165A|2014-06-25|

---

US10233473B2|2019-03-19|

---

AU2012298725B2|2017-06-01|

---

US10081824B2|2018-09-25|

---

US9476036B2|2016-10-25|

---

US20160376622A1|2016-12-29|

---

US10662456B2|2020-05-26|

---

AU2012298725A1|2014-02-13|

---

US20200354763A1|2020-11-12|

---

BR112014004186A2|2017-03-21|

---

CA2846398A1|2013-02-28|

---

WO2013028928A1|2013-02-28|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

DK122686D0|1986-03-17|1986-03-17|Novo Industri As|PREPARATION OF PROTEINS|

---

US5989870A|1986-04-30|1999-11-23|Rohm Enzyme Finland Oy|Method for cloning active promoters|

---

ES2094155T3|1989-06-13|1997-01-16|Genencor Int|PROCEDURE FOR THE NEUTRALIZATION OF CELLS WITHOUT CELL LYSIS.|

---

US5110735A|1989-09-26|1992-05-05|Midwest Research Institute|Thermostable purified endoglucanase from thermophilic bacterium acidothermus cellulolyticus|

---

US5536655A|1989-09-26|1996-07-16|Midwest Research Institute|Gene coding for the E1 endoglucanase|

---

US5275944A|1989-09-26|1994-01-04|Midwest Research Institute|Thermostable purified endoglucanas from acidothermus cellulolyticus ATCC 43068|

---

AU679211B2|1993-03-10|1997-06-26|Novozymes A/S|Enzymes with xylanase activity from aspergillus aculeatus|

---

DE69523052T2|1994-06-03|2002-06-20|Novo Nordisk Biotech Inc|PURIFIED MYCELIOPHTHORA LACCASES AND NUCLEIC ACIDS CODING THEM|

---

EP0777737B1|1994-06-30|2005-05-04|Novozymes Biotech, Inc.|Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein|

---

WO1997026330A2|1996-01-19|1997-07-24|Novo Nordisk Biotech, Inc.|Morphological mutants of filamentous fungi|

---

US6506559B1|1997-12-23|2003-01-14|Carnegie Institute Of Washington|Genetic inhibition by double-stranded RNA|

---

DK1124949T3|1998-10-26|2006-11-06|Novozymes As|Construction and screening of a DNA library of interest in filamentous fungal cells|

---

US6511824B1|1999-03-17|2003-01-28|Exelixis, Inc.|Nucleic acids and polypeptides of invertebrate TWIK channels and methods of use|

---

JP4620253B2|1999-03-22|2011-01-26|ノボザイムス，インコーポレイティド|Promoter for gene expression in fungal cells|

---

AU5279100A|1999-05-19|2000-12-05|Midwest Research Institute|E1 endoglucanase variants y245g, y82r and w42r|

---

US6531644B1|2000-01-14|2003-03-11|Exelixis, Inc.|Methods for identifying anti-cancer drug targets|

---

ES2166316B1|2000-02-24|2003-02-16|Ct Investig Energeticas Ciemat|PROCEDURE FOR THE PRODUCTION OF ETHANOL FROM LIGNOCELLULOSIC BIOMASS USING A NEW THERMOTOLERING YEAST.|

---

JP2004518413A|2000-10-12|2004-06-24|エクセリクシス・インコーポレイテッド|Human ECT2 and usage|

---

JP2004527261A|2001-05-18|2004-09-09|ノボザイムスアクティーゼルスカブ|Polypeptide having cellobiase activity and polynucleotide encoding the same|

---

CA2474033C|2002-01-23|2013-06-04|Royal Nedalco B.V.|Fermentation of pentose sugars|

---

DK1625219T3|2003-05-02|2010-11-01|Novozymes Inc|Methods for preparing secreted polypeptides|

---

US7244605B2|2003-10-28|2007-07-17|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

DK2314605T3|2004-01-30|2014-06-16|Novozymes Inc|Polypeptides with cellulolytic enhancing activity and polynucleotides encoding them|

---

WO2005074656A2|2004-02-06|2005-08-18|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US7960160B2|2004-02-12|2011-06-14|Novozymes, Inc.|Polypeptides having xylanase activity from Aspergillus fumigatus|

---

EP2354222A1|2004-03-25|2011-08-10|Genencor International, Inc.|Cellulase fusion protein and heterologous cellulase fusion construct encoding the same|

---

DK176540B1|2004-09-24|2008-07-21|Cambi Bioethanol Aps|Process for the treatment of biomass and organic waste in order to extract desired biologically based products|

---

EP1869197A2|2005-04-12|2007-12-26|E.I. Dupont De Nemours And Company|Treatment of biomass to obtain ethanol|

---

CN103436509A|2007-05-31|2013-12-11|诺维信股份有限公司|Methods of increasing the cellulolytic enhancing activity of a polypeptide|

---

JP2012504390A|2008-09-30|2012-02-23|ノボザイムス，インコーポレイティド|Methods of using positive and negative selection genes in filamentous fungal cells|

---

CN102227502B|2008-09-30|2016-01-13|诺维信股份有限公司|The method of polypeptide is produced in the enzyme defect mutant of empiecement sickle spore|

---

US8518684B2|2008-11-18|2013-08-27|Novozymes, Inc.|Methods and compositions for degrading cellulosic material|

---

BRPI1008890A2|2009-02-20|2015-08-25|Danisco Us Inc|Fermentation Broth Formulations|

---

US8148103B2|2009-09-29|2012-04-03|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

DK3222716T3|2009-11-06|2020-11-16|Novozymes Inc|COMPOSITIONS FOR SACCHARIFICATION OF CELLULOSIS MATERIAL|

---

BR112012008260A2|2009-11-06|2015-09-15|Novozymes Inc E Novozymes As|polypeptide, polynucleotide, methods for making the polypeptide, for producing a precursor cell mutant, for inhibiting expression of a polypeptide, for producing a protein, for degrading or converting a cellulosic material, for producing a fermentation product, for fermenting a cellulosic material, transgenic plant, part of the plant or plant cell, and double stranded inhibitory rna molecule.|

---

US8986974B2|2009-12-18|2015-03-24|Novozymes, Inc.|Methods for producing polypeptidies in protease-deficient mutants of trichoderma|

---

US8927235B2|2010-12-06|2015-01-06|Novozymes A/S|Methods of hydrolyzing oligomers in hemicellulosic liquor|

---

WO2012103322A1|2011-01-26|2012-08-02|Novozymes A/S|Polypeptides having endoglucanase activity and polynucleotides encoding same|CA2846391A1|2011-08-24|2013-02-28|Novozymes, Inc.|Aspergillus fumigatus cellulolytic enzyme compositions and uses thereof|

---

US20160068878A1|2012-03-26|2016-03-10|Novozymes North America, Inc.|Methods of Preconditioning Cellulosic Material|

---

WO2014092832A2|2012-09-19|2014-06-19|Novozymes, Inc.|Methods for enhancing the degradation or conversion of cellulosic material|

---

CN104755617B|2012-10-08|2019-01-01|诺维信公司|Polypeptide with cellulolytic enhancing activity and the polynucleotides for encoding them|

---

WO2014060378A1|2012-10-16|2014-04-24|Dsm Ip Assets B.V.|Cell wall deconstruction enzymes of pseudocercosporella herpotrichoides and|uses thereof|

---

WO2014066141A2|2012-10-24|2014-05-01|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

CA2892031A1|2012-11-27|2014-06-05|Novozymes A/S|Milling process|

---

EP2925790B1|2012-11-27|2021-07-07|Novozymes A/S|Milling process|

---

WO2014085439A1|2012-11-30|2014-06-05|Novozymes A/S|Processes for producing fermentation products|

---

CN104870639A|2012-12-14|2015-08-26|诺维信公司|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US20150337280A1|2012-12-19|2015-11-26|Novozymes A/S|Polypeptides Having Cellulolytic Enhancing Activity And Polynucleotides Encoding Same|

---

EP2959004B1|2013-02-21|2021-01-13|Novozymes A/S|Methods of saccharifying and fermenting a cellulosic material|

---

DK2964760T3|2013-03-08|2021-07-26|Novozymes Inc|Cellobiohydrolase variants and polynucleotides encoding them|

---

WO2014182990A1|2013-05-10|2014-11-13|Novozymes A/S|Polypeptides having xylanase activity and polynucleotides encoding same|

---

CN105431528A|2013-08-30|2016-03-23|诺维信公司|Enzyme composition and uses thereof|

---

CA2919157A1|2013-09-04|2015-03-12|Novozymes A/S|Processes for increasing enzymatic hydrolysis of cellulosic material|

---

CN105658804A|2013-11-01|2016-06-08|诺维信公司|Methods of saccharifying and fermenting a cellulosic material|

---

WO2015081139A1|2013-11-26|2015-06-04|Novozymes A/S|Enzyme compositions and uses thereof|

---

EP3511418B1|2014-01-07|2020-07-15|Novozymes A/S|Corollospora maritima mannanase and its use|

---

EP3122858B1|2014-03-25|2019-08-21|Novozymes A/S|Dishwashing composition containing cellulytic enzymes and use thereof|

---

DK3152315T3|2014-06-06|2018-11-26|Novozymes As|ENZYME COMPOSITIONS AND APPLICATIONS THEREOF|

---

WO2016029107A1|2014-08-21|2016-02-25|Novozymes A/S|Process for saccharifying cellulosic material under oxygen addition|

---

BR112017003847A2|2014-08-28|2018-02-27|Renescience As|process for solubilizing waste such as municipal solid waste , and process for producing a fermentation product|

---

WO2016037096A1|2014-09-05|2016-03-10|Novozymes A/S|Carbohydrate binding module variants and polynucleotides encoding same|

---

BR112017005914A2|2014-09-23|2017-12-12|Novozymes As|process for ethanol production, and recombinant fermenting organism.|

---

US10557127B2|2015-02-24|2020-02-11|Novozymes A/S|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2016145084A1|2015-03-09|2016-09-15|Novozymes A/S|Methods of introducing multiple expression constructs into a eukaryotic cell|

---

US20180051306A1|2015-03-12|2018-02-22|Novozymes A/S|Enzymatic Hydrolysis with Hemicellulolytic Enzymes|

---

BR112017019332A2|2015-03-12|2018-07-24|Beta Renewables Spa|processes for improving a saccharification glucose or xylose yield of a lignocellulosic material and for producing a fermentation product from a lignocellulosic material|

---

EP3268486A1|2015-03-12|2018-01-17|Novozymes A/S|Multi-stage enzymatic hydrolysis of lignocellulosic biomass employing an oxidoreductase with an aa9 polypeptide|

---

WO2016188459A1|2015-05-27|2016-12-01|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

US10676727B2|2015-06-18|2020-06-09|Novozymes A/S|Polypeptides having trehalase activity and the use thereof in process of producing fermentation products|

---

CN107922896A|2015-06-30|2018-04-17|诺维信公司|Laundry detergent composition, for washing method and composition purposes|

---

EP3325616A1|2015-07-24|2018-05-30|Novozymes, Inc.|Polypeptides having arabinofuranosidase activity and polynucleotides encoding same|

---

US20180216089A1|2015-07-24|2018-08-02|Novozymes, Inc.|Polypeptides Having Beta-Xylosidase Activity And Polynucleotides Encoding Same|

---

WO2017040907A1|2015-09-04|2017-03-09|Novozymes A/S|Methods of inhibiting aa9 lytic polysaccharide monooxygenase catalyzed inactivation of enzyme compositions|

---

US10479984B2|2015-09-22|2019-11-19|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2017070219A1|2015-10-20|2017-04-27|Novozymes A/S|Lytic polysaccharide monooxygenasevariants and polynucleotides encoding same|

---

CN114054481A|2015-11-02|2022-02-18|雷内科学有限公司|Dissolving municipal solid waste with mixed enzymes|

---

PL3387139T3|2015-12-10|2020-11-02|Dsm Ip Assets B.V.|Beta-glucosidase and uses thereof|

---

JP2019501018A|2015-12-23|2019-01-17|ノボザイムス アクティーゼルスカブ|Enhancing sludge dewaterability by enzymatic treatment|

---

RU2710554C1|2016-02-19|2019-12-27|Интерконтинентал Грейт Брендс Ллк|Methods for formation of multiple valuable streams from biomass sources|

---

BR112018067371A2|2016-03-02|2019-01-15|Novozymes As|cellobiohydrolase variant, enzyme composition, whole broth formulation or cell culture composition, polynucleotide, recombinant host cell, plant, plant part or transgenic plant cell, methods for producing and obtaining a cellobio variant. hydrolase, transgenic plant, and processes for degradation of a cellulosic material, for production of a fermentation product and for fermentation of a cellulosic material|

---

EP3433358A1|2016-03-24|2019-01-30|Novozymes A/S|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2017205535A1|2016-05-27|2017-11-30|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

WO2018026868A1|2016-08-01|2018-02-08|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

WO2018085370A1|2016-11-02|2018-05-11|Novozymes A/S|Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material|

---

WO2018098381A1|2016-11-23|2018-05-31|Novozymes A/S|Improved yeast for ethanol production|

---

WO2018106792A1|2016-12-06|2018-06-14|Novozymes A/S|Improved processes for production of ethanol from xylose-containing cellulosic substrates using engineered yeast strains|

---

WO2018220116A1|2017-05-31|2018-12-06|Novozymes A/S|Xylose fermenting yeast strains and processes thereof for ethanol production|

---

BR112019025391A2|2017-06-02|2020-07-07|Novozymes A/S|improved yeast for ethanol production|

---

DK3645555T3|2017-06-28|2022-03-07|Novozymes As|Polypeptides with trehalase activity and polynucleotides encoding them|

---

US11220679B2|2017-08-08|2022-01-11|Novozymes A/S|Polypeptides having trehalase activity|

---

CA3089135A1|2018-01-29|2019-08-01|Novozymes A/S|Microorganisms with improved nitrogen utilization for ethanol production|

---

EP3752626A1|2018-02-15|2020-12-23|Novozymes A/S|Improved yeast for ethanol production|

---

WO2019201765A1|2018-04-20|2019-10-24|Renescience A/S|Method for determining chemical compounds in waste|

---

WO2019241614A1|2018-06-14|2019-12-19|Ecolab Usa Inc.|Compositions comprising enzyme and quaternary ammonium compounds|

---

WO2019241615A1|2018-06-14|2019-12-19|Ecolab Usa Inc.|Synergistic cellulase-surfactant interactions for degradation of bacterial cellulose|

---

WO2020023411A1|2018-07-25|2020-01-30|Novozymes A/S|Enzyme-expressing yeast for ethanol production|

---

CN113286889A|2018-10-08|2021-08-20|诺维信公司|Enzyme-expressing yeast for producing ethanol|

---

US20220025348A1|2018-12-12|2022-01-27|Novozymes A/S|Polypeptides Having Xylanase Activity And Polynucleotides Encoding Same|

---

EP3894565A1|2018-12-12|2021-10-20|Novozymes A/S|Methods for increasing the productivity of a filamentous fungal cell in the production of a polypeptide|

---

WO2020206058A1|2019-04-02|2020-10-08|Novozymes A/S|Process for producing a fermentation product|

---

WO2021021458A1|2019-07-26|2021-02-04|Novozymes A/S|Microorganisms with improved nitrogen transport for ethanol production|

---

CN114127124A|2019-08-06|2022-03-01|诺维信公司|Fusion proteins for enhanced enzyme expression|

---

WO2021048164A1|2019-09-10|2021-03-18|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2021055395A1|2019-09-16|2021-03-25|Novozymes A/S|Polypeptides having beta-glucanase activity and polynucleotides encoding same|

---

WO2021119304A1|2019-12-10|2021-06-17|Novozymes A/S|Microorganism for improved pentose fermentation|

---

WO2021148278A1|2020-01-24|2021-07-29|Novozymes A/S|Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide|

---

WO2021163030A2|2020-02-10|2021-08-19|Novozymes A/S|Polypeptides having alpha-amylase activity and polynucleotides encoding same|

法律状态:
2018-03-27| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-07-16| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2020-10-13| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2020-12-15| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 23/08/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161526833P| true| 2011-08-24|2011-08-24|

---

US61/526833|2011-08-24|

---

US201161577609P| true| 2011-12-19|2011-12-19|

---

US61/577609|2011-12-19|

---

PCT/US2012/052163|WO2013028928A1|2011-08-24|2012-08-23|Cellulolytic enzyme compositions and uses thereof|

---